Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • prajor
    Junior Member
    • Dec 2011
    • 1

    SoapSNP errors

    Hello, I am getting these errors when running soapsnp (infact I am running crossbow and it is in turn running soapsnp) . Any help would be appreciated.

    Code:
    * reporter:counter:SOAPsnp,Occurrences of quality value [30:40) in wrapper,543
    * reporter:counter:SOAPsnp,Occurrences of quality value [20:30) in wrapper,801
    * reporter:counter:SOAPsnp,Occurrences of quality value [10:20) in wrapper,1311
    * reporter:counter:SOAPsnp,Occurrences of quality value [40:50) in wrapper,4704
    * reporter:counter:SOAPsnp,Occurrences of quality value [0:10) in wrapper,2678
    * reporter:counter:SOAPsnp,Occurrences of quality value [30:40) in wrapper,568
    * reporter:counter:SOAPsnp,Occurrences of quality value [20:30) in wrapper,747
    * reporter:counter:SOAPsnp,Occurrences of quality value [10:20) in wrapper,1326
    * reporter:counter:SOAPsnp,Occurrences of quality value [40:50) in wrapper,4748
    * reporter:counter:SOAPsnp,Occurrences of quality value [0:10) in wrapper,2607
    * reporter:counter:SOAPsnp,Occurrences of quality value [30:40) in wrapper,549
    * reporter:counter:SOAPsnp,Occurrences of quality value [20:30) in wrapper,778
    * reporter:counter:SOAPsnp,Occurrences of quality value [10:20) in wrapper,1347
    * reporter:counter:SOAPsnp,Occurrences of quality value [40:50) in wrapper,4565
    * reporter:counter:SOAPsnp,Occurrences of quality value [0:10) in wrapper,2762
    * reporter:counter:SOAPsnp,Occurrences of quality value [30:40) in wrapper,594
    * reporter:counter:SOAPsnp,Occurrences of quality value [20:30) in wrapper,740
    * Read the last line of input
    * reporter:counter:SOAPsnp wrapper,Ranges processed,1
    * reporter:counter:SOAPsnp wrapper,Alignments processed,761653
    * Soapsnp.pl: Genotyping chromosome 0 3000000-4000000 using 761653 alignments: Wed Feb 22 17:33:29 IST 2012
    * Soapsnp.pl:   chromosome 0 is haploid; using args "-r 0.0001 -m"
    * Soapsnp.pl: head -4 .tmp.1000000.0003:
    * 0	0003	002999964	+	GATGTTTAAGGCGCGGTCAGCATTTCCAGATCGCTA	IAIAIIIIIGIII9'I<./7&/DII".+(%'#&"%'	0	33:A>C	0	r
    * 0	0003	002999965	+	ATGTTTAAGGCGCGGTCAGCATTTCCAGATCGTTCC	IIIIIIIIIIIIIIIID1IE6III)0"+'/*%"("%	0	32:A>T,34:A>C,35:A>C	0	r
    * 0	0003	002999967	-	GTGGAAGGCGCGGTAAGCATTTCCAGATCGATAAGC	&)"#&%&&"#'&-6%'*(6I-79=IC@IIIIIIIII	0	21:C>A,32:T>G,33:T>G	0	r
    * 0	0003	002999968	-	TAAAAGGCGCGGTCATCATTTCCAGATCGATAAGCC	"#$"+""&#+%#($*#%+,*,%(;-00.F?3II:I7	0	20:G>T,33:T>A,34:T>A	0	r
    * Soapsnp.pl: tail -4 .tmp.1000000.0003:
    * 0	0003	003999994	+	CTGGATCTTCTTTGCCCAGCGCCGCCGGACCGTTTT	IIIIIIIIIIIIIIIIII4:I8I-<%A"#$$-%)'$	0	25:A>C,28:G>A,29:A>C,32:A>T,35:G>T	0	r
    * 0	0003	003999996	+	GGATCTTCTTTGCCCAGCGCCGCAGGTTCGGTTTCG	IICIIIIIIIIAIII2II=G<II+10""))",$%"$	0	26:G>T,27:A>T,30:A>G,33:G>T,34:A>C	0	r
    * 0	0003	003999999	+	TCTTCTTTGCCCAGCGCCGCCGGCACGATTGAGAGT	@@II8IIHCI266I&46*3/"/#"('*#)#$"""&%	0	20:A>C,23:G>C,34:A>G,35:G>T	0	r
    * 0	0003	003999999	-	TGAGCTATGACCAGCGCCGCAGGAACGATTGAGAAG	"""#&"#""&3$-&=%0I=II>IIIIAI+9IIIIII	0	12:G>A,26:C>A,29:T>A,32:T>G,33:T>A,34:C>G	0	r
    * reporter:counter:SOAPsnp wrapper,SNP files missing,1
    * Soapsnp.pl: Warning: /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/snps/0.snps doesn't exist
    * Soapsnp.pl: ls -l /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/snps
    * Soapsnp.pl: total 0
    * Soapsnp.pl: Warning: neither /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/snps/chr0.snps nor /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/snps/0.snps exist; not using known SNPs
    * Soapsnp.pl: ls -al /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/snps
    * Soapsnp.pl: total 8
    * drwxr-xr-x 2 xyzuser hadoop 4096 2012-02-22 09:36 .
    * drwxr-xr-x 6 xyzuser hadoop 4096 2012-02-22 09:36 ..
    * Soapsnp.pl: /home/xyzuser//cbexec/bin/linux32/soapsnp -i .tmp.1000000.0003 -d /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/sequences/chr0.fa -o .tmp.snps  -z '!' -L 36 -c -H -T .range_3000000_4000000 -r 0.0001 -m -2 -u -n -q >.soapsnp.14632.stdout 2>.soapsnp.14632.stderr
    * Soapsnp.pl: soapsnp returned 33792
    * Soapsnp.pl: command: /home/xyzuser//cbexec/bin/linux32/soapsnp -i .tmp.1000000.0003 -d /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/sequences/chr0.fa -o .tmp.snps  -z '!' -L 36 -c -H -T .range_3000000_4000000 -r 0.0001 -m -2 -u -n -q >.soapsnp.14632.stdout 2>.soapsnp.14632.stderr
    * Soapsnp.pl: stdout from soapsnp:
    * Soapsnp.pl: stderr from soapsnp:
    * -i is set to .tmp.1000000.0003
    * -d is set to /home/xyzuser/bio/crossbow/crossbow-1.1.2/crossref/e_coli/sequences/chr0.fa
    * -o is set to .tmp.snps
    * Standard Fastq System Set
    * -L is set to 36
    * -c is set
    * -T is set to .range_3000000_4000000
    * -r is set to 0.0001
    * -m is set
    * -2 is set
    * -u is set
    * -n is set
    * -q is set
    * Read 5498450 from 78551 lines of input FASTA sequence 17:33:29
    * Finished loading and binarizing chromosome 17:33:29
    * Finished parsing 0 known SNPs 17:33:29
    * Reading Chromosome and dbSNP information Done.
    * Read target region done.
    * Training correction matrix in Crossbow format17:33:30
    * Correction Matrix Done 17:33:38
    * Illegal instruction
    * Soapsnp.pl: range: 0	3000000	4000000
    * Soapsnp.pl: head -4 .tmp.snps:
    * Soapsnp.pl: tail -4 .tmp.snps:
    * Dying following soapsnp returning non-zero 33792 at /home/xyzuser//cbexec/Soapsnp.pl line 372.
    ******
    Fatal error 1.1.2:R330: Aborting because child with PID 14405 exited abnormally
    
    When requesting support, please include the full output printed here.
    If a child process was the cause of the error, the output should
    include the relevant error message from the child's error log.  You may
    be asked to provide additional files as well.
    Non-zero exitlevel from SNP calling stage

Latest Articles

Collapse

  • SEQadmin2
    Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
    by SEQadmin2


    Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

    The systematic characterization of the human proteome has
    ...
    07-20-2026, 11:48 AM
  • SEQadmin2
    Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
    by SEQadmin2



    Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
    ...
    07-09-2026, 11:10 AM
  • SEQadmin2
    Cancer Drug Resistance: The Lingering Barrier to Rising Survival
    by SEQadmin2



    Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

    There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
    07-08-2026, 05:17 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by SEQadmin2, 07-24-2026, 12:17 PM
0 responses
30 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-23-2026, 11:41 AM
0 responses
23 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-20-2026, 11:10 AM
0 responses
212 views
0 reactions
Last Post SEQadmin2  
Started by SEQadmin2, 07-13-2026, 10:26 AM
0 responses
78 views
0 reactions
Last Post SEQadmin2  
Working...