Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • sram
    Junior Member
    • Jun 2009
    • 7

    Problem with Celera Assembler

    Hello,

    I have short reads sequences already in a FRG file (converted from fasta to amos then to frg) which I would like to assemble using Celera Assembler, for which I run the following command:

    runCA -d testDir -p testPrefix testShortReads.frg

    After running several subprograms (gatekeeper, initialTrim, meryl, etc) successfully it fails running overlapTrim:

    ERROR: Failed with signal ABRT (6)
    step OverlapTrim failed with 'Failed to build the obt store.'

    Anyone can help me with this problem?
    I would appreciate any help. Thanks.
  • sklages
    Senior Member
    • May 2008
    • 628

    #2
    CA will not assemble "shorts reads", if you mean Solexa or Solid.
    Have a look ath their wiki at https://sourceforge.net/apps/mediawi...lexa_Platforms

    If you have FLX or titanium data then the information provided is not enough ;-)

    Cheers,
    Sven

    Comment

    • sram
      Junior Member
      • Jun 2009
      • 7

      #3
      Originally posted by sklages View Post
      CA will not assemble "shorts reads", if you mean Solexa or Solid.
      Have a look ath their wiki at https://sourceforge.net/apps/mediawi...lexa_Platforms

      If you have FLX or titanium data then the information provided is not enough ;-)

      Cheers,
      Sven
      OK, I should have said a little more about the sequences. They are 454 FLX. A sample of the original fasta file is here:

      >000038_0115_1501 length=95 uaccno=EYVY07101AKEWF
      CGTTACGTCTTCAAGCCTCAGAAAATTAAATCTTGATGCAAAAGGTCGAGATAAATGGTGCAGGCGGATTTTTCCCCGNGTCTGGTATCCAAGTT

      However I am presenting the input data to CA in FRG as requested and as I said in the original message.

      Any hint?
      Thanks for your time.

      ---sram

      Comment

      • sklages
        Senior Member
        • May 2008
        • 628

        #4
        This looks like 454 GS20 data. Sure it is FLX data?

        Anyway, if possible you always start from the SFF files. Generating input for CA from SFF files is best done with https://sourceforge.net/apps/mediawi...Inputs#sffToCA

        There will (probably) be no general solution for this kind of failure; there should have been written some error logs. Take a look at these.

        Also take a look at the help page https://sourceforge.net/apps/mediawi...php?title=Help
        and contact the authors if you cannot solve the problem.

        Nevertheless, if you have a simple solution you should post it here ;-)

        cheers,
        Sven

        Comment

        • archananraja
          Junior Member
          • Dec 2010
          • 3

          #5
          Hi All,
          I am trying to run Celera assembler on the sun grid engine using the below option.

          perl /usr/local/wgs-6.1/Linux-amd64/bin/runCA-OBT.pl useGrid=1 scriptOnGrid=1 -d /roche/Trimmed_Reads/454/Unpaired/ -p grid_test /roche/Trimmed_Reads/454/Unpaired/*.frg ovlMemory="4GB --hashload 0.8 --hashstrings 100000" ovlThreads=2 ovlHashBlockSize=180000 ovlRefBlockSize=2000000 frgCorrBatchSize=200000 frgCorrThreads=2 ovlCorrBatchSize=800000 unitigger=bog

          The script executes but I am getting permission error inspite of changing permissions to the bin directory containing the runCA command.I have pasted runCA.sge.out and runCA.sge.out.sh error messages below.I would be happy if someone could help me resolve this issue.

          runCA.sge.out.01

          Warning: no access to tty (Bad file descriptor).
          Thus no job control in this shell.
          /bin/.: Permission denied.
          syst=Linux: Command not found.
          arch=x86_64: Command not found.
          name=454rig.dhmriad.local: Command not found.
          arch: Undefined variable.

          runCA.sge.out.01.sh
          #!/bin/sh
          #
          # Attempt to (re)configure SGE. For reasons Bri doesn't know,
          # jobs submitted to SGE, and running under SGE, fail to read his
          # .tcshrc (or .bashrc, limited testing), and so they don't setup
          # SGE (or ANY other paths, etc) properly. For the record,
          # interactive SGE logins (qlogin, etc) DO set the environment.

          . $SGE_ROOT/$SGE_CELL/common/settings.sh

          # On the off chance that there is a pathMap, and the host we
          # eventually get scheduled on doesn't see other hosts, we decide
          # at run time where the binary is.

          syst=`uname -s`
          arch=`uname -m`
          name=`uname -n`

          if [ "$arch" = "x86_64" ] ; then
          arch="amd64"
          fi
          if [ "$arch" = "Power Macintosh" ] ; then
          arch="ppc"
          fi

          bin="/usr/local/wgs-6.1/$syst-$arch/bin"

          /usr/bin/env perl $bin/runCA "useGrid=1" "scriptOnGrid=1" -d "/roche/Trimmed_Reads/454/Unpaired/" -p "grid_test" "/roche/Trimmed_Reads/454/Unpaired/FR6EAL4.frg" "/roche/Trimmed_Reads/454/Unpaired/FRK90FP0.frg" "/roche/Trimmed_Reads/454/Unpaired/FSIT0PR0.frg" "/roche/Trimmed_Reads/454/Unpaired/FTNMD73.frg" "/roche/Trimmed_Reads/454/Unpaired/FUORSTX0.frg" "/roche/Trimmed_Reads/454/Unpaired/GMEFJA40.frg" "ovlMemory=4GB --hashload 0.8 --hashstrings 100000" "ovlThreads=2" "ovlHashBlockSize=180000" "ovlRefBlockSize=2000000" "frgCorrBatchSize=200000" "frgCorrThreads=2" "ovlCorrBatchSize=800000" "unitigger=bog"


          Thanks,
          AR

          Comment

          • stvos
            Junior Member
            • Aug 2011
            • 7

            #6
            @archananraja,

            i AM HAVING THE SAME PROBLEM
            Are you sure that your current directory from which you launch the command and the filepath in your command line are the same?
            This could solve your permissions problem

            Comment

            • stvos
              Junior Member
              • Aug 2011
              • 7

              #7
              Hi,

              I am trying out Celera for assembling de novo my 1.8 billion illumina reads.
              Celera RunCA version 6.1.
              I have a question about the `Sun Grid Engine Options`
              On the following web page, they precise how you can adjust this grid to a small Sanger dataset:
              Download Whole-Genome Shotgun Assembler for free. Celera Assembler (CA) is a whole-genome shotgun (WGS) assembler for the reconstruction of genomic DNA sequence from WGS sequencing data.

              But I find no information how I could use this for a large Illumina dataset of 75-100b reads. Especially because I have 1.8 billion reads, I was wondering how I could adjust the CPU and the Memory best for my kind of data with the Sun Grid Engine.

              Does anyone have experience with Celera and large Illumina datasets?
              I know they say CA1.6 should be able to assemble 1 billion reads, according to their website,and so I am hoping it could work for more too!

              Comment

              Latest Articles

              Collapse

              • SEQadmin2
                Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                by SEQadmin2


                I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

                Here are nine questions we think about, in roughly the order they matter, before...
                06-18-2026, 07:11 AM
              • SEQadmin2
                From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
                by SEQadmin2


                Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


                The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
                ...
                06-02-2026, 10:05 AM

              ad_right_rmr

              Collapse

              News

              Collapse

              Topics Statistics Last Post
              Started by SEQadmin2, 06-17-2026, 06:09 AM
              0 responses
              40 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 06-09-2026, 11:58 AM
              0 responses
              102 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 06-05-2026, 10:09 AM
              0 responses
              123 views
              0 reactions
              Last Post SEQadmin2  
              Started by SEQadmin2, 06-04-2026, 08:59 AM
              0 responses
              114 views
              0 reactions
              Last Post SEQadmin2  
              Working...