Hi all,
I am trying to assembly a trancriptome with 454 and Illumina sequences using newbler2.6. The runAssembler finished without error. It charges the sequences; but no illumina sequences have been aligned, only 454 ones. It seems that the program don't use the file to do the assemble, in the tests only expend 6 second in finish the analysis. We have tested with different parameters and options without result. Could you help me?
Thanks,
Ximo
/runAssembly -cdna -mi 95 -ml 20 illumina_.sfastaq 454_.sfastaq
454NewblerMetrics.txt: readAlignmentResults
{
file
{
path = "/illumina_.sfastq";
numAlignedReads = 0, 0.00%;
numAlignedBases = 0, 0.00%;
inferredReadError = 0.00%, 0;
I have tried to test if runAssembly can read my illumina_fastaq sequences with this test
/runAssembly -cdna -mi 95 -ml 50% illumina_test_file.fastaq
output:
>Created assembly project directory newbler_test
>1 read file successfully added.
> test_100000_ill (Fastq dataset, with standard scores)
>Assembly computation starting at: Tue Mar 27 12:35:19 2012 (v2.6 (20110517_1502))
>Indexing/Screening test_100000_ill (with quality scores)...
> -> 100000 reads, 3668500 bases.
>Building contigs/isotigs...
> -> 0 large contigs, 0 all contigs
> -> 0 isogroups, 0 isotigs
>Computing signals...
> -> 0 of 0...
>Checkpointing...
>Generating output...
> -> 0 of 0...
>Assembly computation succeeded at: Tue Mar 27 12:35:23 2012
The runAssembler can read my sequences (test without cdna option):
/runAssembly -mi 95 -ml 50% -urt illumina_test_file.fastaq
runAssembly -o newbler_test test_file.100000_ill [12:41:44]
Output:
>Created assembly project directory newbler_test
>1 read file successfully added.
>test_100000_ill (Fastq dataset, with standard scores)
>Assembly computation starting at: Tue Mar 27 13:02:27 2012 (v2.6 (20110517_1502))
>Indexing test_100000_ill (with quality scores)...
> -> 100000 reads, 3668500 bases.
> Warning: Suspected 5' primer AAGCAGTGGTATCAACGCAGAGTAC, 15773 exact matches found.
> Warning: Suspected 5' primer AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTT, 8227 exact matches found.
> Warning: Suspected 3' primer GTACTCTGCGTTGATACCACTGCTT, 2397 exact matches found.
> Warning: Suspected 3' primer AAAAAAAAAAAAAGTACTCTGCGTTGATACCACTGCTT, 8227 exact matches found.
>Building contigs/scaffolds...
> -> 0 large contigs, 0 all contigs
>Computing signals...
-> 0 of 0...
>Checkpointing...
>Generating output...
> -> 0 of 0...
>Assembly computation succeeded at: Tue Mar 27 13:02:29 2012
I am trying to assembly a trancriptome with 454 and Illumina sequences using newbler2.6. The runAssembler finished without error. It charges the sequences; but no illumina sequences have been aligned, only 454 ones. It seems that the program don't use the file to do the assemble, in the tests only expend 6 second in finish the analysis. We have tested with different parameters and options without result. Could you help me?
Thanks,
Ximo
/runAssembly -cdna -mi 95 -ml 20 illumina_.sfastaq 454_.sfastaq
454NewblerMetrics.txt: readAlignmentResults
{
file
{
path = "/illumina_.sfastq";
numAlignedReads = 0, 0.00%;
numAlignedBases = 0, 0.00%;
inferredReadError = 0.00%, 0;
I have tried to test if runAssembly can read my illumina_fastaq sequences with this test
/runAssembly -cdna -mi 95 -ml 50% illumina_test_file.fastaq
output:
>Created assembly project directory newbler_test
>1 read file successfully added.
> test_100000_ill (Fastq dataset, with standard scores)
>Assembly computation starting at: Tue Mar 27 12:35:19 2012 (v2.6 (20110517_1502))
>Indexing/Screening test_100000_ill (with quality scores)...
> -> 100000 reads, 3668500 bases.
>Building contigs/isotigs...
> -> 0 large contigs, 0 all contigs
> -> 0 isogroups, 0 isotigs
>Computing signals...
> -> 0 of 0...
>Checkpointing...
>Generating output...
> -> 0 of 0...
>Assembly computation succeeded at: Tue Mar 27 12:35:23 2012
The runAssembler can read my sequences (test without cdna option):
/runAssembly -mi 95 -ml 50% -urt illumina_test_file.fastaq
runAssembly -o newbler_test test_file.100000_ill [12:41:44]
Output:
>Created assembly project directory newbler_test
>1 read file successfully added.
>test_100000_ill (Fastq dataset, with standard scores)
>Assembly computation starting at: Tue Mar 27 13:02:27 2012 (v2.6 (20110517_1502))
>Indexing test_100000_ill (with quality scores)...
> -> 100000 reads, 3668500 bases.
> Warning: Suspected 5' primer AAGCAGTGGTATCAACGCAGAGTAC, 15773 exact matches found.
> Warning: Suspected 5' primer AAGCAGTGGTATCAACGCAGAGTACTTTTTTTTTTTTT, 8227 exact matches found.
> Warning: Suspected 3' primer GTACTCTGCGTTGATACCACTGCTT, 2397 exact matches found.
> Warning: Suspected 3' primer AAAAAAAAAAAAAGTACTCTGCGTTGATACCACTGCTT, 8227 exact matches found.
>Building contigs/scaffolds...
> -> 0 large contigs, 0 all contigs
>Computing signals...
-> 0 of 0...
>Checkpointing...
>Generating output...
> -> 0 of 0...
>Assembly computation succeeded at: Tue Mar 27 13:02:29 2012
Comment