HTSeq dealing with "*" qualities

[kamsen]

Hi everyone,

I started using HTSeq a couple of days ago and now encountered a problem. Maybe someone knows a workaround.

I am interating over an sam file and cant find a solution for the error:
(also described here http://seqanswers.com/forums/showthread.php?t=12091)

ValueError: 'seq' and 'qualstr' do not have the same length.

The Alignment is from Bowtie2 and lacks the qualitystring (only a "*" is in the file, but the complete read sequence is there).

Like: blaaaaa ACTACTATCTAC * blaaaaa


Since I have a lot of files I cant perform a filtering in the first place, because I do not want to touch those big files twice.

thanks in advance.

EDIT:
I am using the latest release of HTSeq.



regards

[maubp]

Sounds like a bug in HTSeq - as discussed in the linked thread, the SAM/BAM file format explicitly allows the sequencing qualities to be omitted (which in SAM is represented with the * character).

Have you contacted the HTSeq authors?

P.S. Saying you use the latest version isn't as helpful as saying the actual version you are using. People may read this thread later on

[Simon Anders]

Yes, that's a limitation of HTSeq. Fixing this has been on my to-do list since a while; sorry that it's still not done.

[kamsen]

Just a few remarks to close this topic:

1) I was talking about version 0.5.3p3
2) I made quick & dirty workaround in the code (__init__ modul l. 537) which worked for me. If somebody encounters this problem one could easily just return the line from the .sam file and create 0 qualities / read the original ones. After that the conversion to the Alignment format will work again.
3) Thanks anyway for your nice package Simon!

regards

[NicoBxl]

Yes, that's a limitation of HTSeq. Fixing this has been on my to-do list since a while; sorry that it's still not done.

Hi Simon,

Do you fix this bug ? I've the same problem with tophat 2.0.0 bam files.

samtools view -h -o out.sam in.bam
htseq-count out.sam annotation.gtf > htseq_out.txt

gives me

100000 GFF lines processed.
200000 GFF lines processed.
283699 GFF lines processed.
Error occured in line 36 of file out.sam.
Error: ("'seq' and 'qualstr' do not have the same length.", 'line 36 of file out.sam')
[Exception type: ValueError, raised in _HTSeq.pyx:765]

[Simon Anders]

I've just fixed this. In HTSeq 0.5.3p4, SAM files with "*" in the quality field are accepted. Sorry that this took a while.

[NicoBxl]

Thanks Simon, it worked great.

[fishinabarrel]

Dear Simon,

You are my hero.
Just ran into this problem yesterday. And by this morning a solution was already in place.
I owe you a beer.

[fishinabarrel]

I should also add that I installed HTSeq-0.5.3p3 to encounter the qual problem and upon installing HTSeq-0.5.3p4, all was well.

[dharan]

Problem is still seen in HTSeq - v0.5.3p5

Dear Simon,

I had installed the latest version of HTseq (HTSeq-0.5.3p5.tar.gz) to solve the problem but it looks like for me the error still persists.

I am still facing this error:
Error: ("'seq' and 'qualstr' do not have the same length.", 'line 2671032 of file ..)
[Exception type: ValueError, raised in _HTSeq.pyx:765]

Can you please help me out?

Thanks,
Dharanya

[maubp]

It would be nice if the HTSeq error message included the two unmatched lengths - but can you show us what line 2671032 of your input file is? This may not be due to the * for missing qualities at all, but a real error in the data.

[dharan]

Hi,

Here is the line from that file:


HWI-ST790:1:1101:1261:140607#ACTTGA 329 contig_126150 342 3 100M * 0 0 GTCCAGGTTGGTGGACCTCTCAATCATGTTGTCACCCTCAAACCCAGAGATGGGGACGAAGGGAACCTTGTTAGGGTTGTAGCCGACCTTCTTCAGGTAG * AS:i:-7 XN:i:0 XM:i:2 XO:i:0 XG:i:0 NM:i:2 MD:Z:3A67C28 YT:Z:UU NH:i:2 CC:Z:contig_223383 CP:i:208 HI:i:0

Cheers,
Dharanya

[maubp]

Can you double check which HTSeq you are using? Perhaps an older copy is taking precedence in your PATH, or the update didn't install properly.

[dharan]

May be there might be a problem with the installation. I will go through it again and let you know if there are any problems still.
Thanks

[chadn737]

As an aside, the latest version of Tophat 2 no longer has the "*" qualities problems.