Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • fastx_toolkit can't work

    when i use fastx_toolkits ,just like fastq_quality_filter:

    $ fastq_quality_filter -q 5 -p 50 -i ./SampleS_1.fq -o ./SampleSfilter_1.fq

    unfortunately,it returns as:

    fastq_quality_filter: Invalid quality score value (char '#' ord 35 quality value -29) on line 4

    how can I solve it ?

  • #2
    The program is using solexa quality scores (starting at 64) instead of sanger (starting at 33). According to the fastx website, support for sanger quality scores was added in version 0.0.13. Which version are you running?

    Comment


    • #3
      Try the command line option -Q 33 to indicate Sanger phred scores. That option has worked for me in the past

      Comment


      • #4
        Originally posted by Alex Renwick View Post
        The program is using solexa quality scores (starting at 64) instead of sanger (starting at 33). According to the fastx website, support for sanger quality scores was added in version 0.0.13. Which version are you running?
        i use the version 0.0.13,but it doesn't work too,how can i convert sanger fastq to illumina fastq format?

        Comment


        • #5
          Originally posted by dfjenkins3 View Post
          Try the command line option -Q 33 to indicate Sanger phred scores. That option has worked for me in the past
          i add this option ,but another error is happened like:

          fastq_quality_filter: Invalid quality score value (char 'J' ord 74 quality value 41) on line 4

          Comment


          • #6
            Can you post a few (12) lines of your FastQ file?

            Comment


            • #7
              I always thought it was -Q33... Does -Q 33 work?

              [edit] Oh, yes, it does.

              Comment


              • #8
                Originally posted by sisch View Post
                can you post a few (12) lines of your fastq file?
                @hwi-st298:170:81mg3abxx:1:1101:1349:2455 1:n:0:ttaggc
                ctggttcagccttcttaggctcttcttctgtttccttacctcagatcggaagagcacacgtctgaactccagtcacttaggcatttcgtatgacgtatgt
                +
                cccfffffghghfhgiijjfhegi?fhiihfchggggcegggicgebchfhgdhgiiibaf@fh7@@e;7=a;aadd>ccbcca################
                @hwi-st298:170:81mg3abxx:1:1101:1372:2461 1:n:0:ttaggc
                agacggtgttgcataagctgttgtatctgttgctgttgaaactgaaactgctgctgttgctgcttttgttttttagatcggcagggcacacgtgtgcgac
                +
                @@@fff@dfhgff<gaeehggg@@ehafhiiibgg<?ff<?<bf<fg@gg?be<<3?88bf#######################################
                @hwi-st298:170:81mg3abxx:1:1101:1866:2486 1:n:0:ttaggc
                gtcactttgtacctcttctcaaattaggaaaatacgaagttcgaggaacgcctttcgttctctttttttcttggtcggcagggtcagggcctttcttgct
                +
                @@cdffffdddhhegeggeegeh>hhhiigiij>ffcgggeghid0?dfdfggiig1=;;ceggcac<<ce@a@>>>;??>95(9<(38<?<a#######

                Comment


                • #9
                  Originally posted by letusgo View Post
                  i add this option ,but another error is happened like:

                  fastq_quality_filter: Invalid quality score value (char 'J' ord 74 quality value 41) on line 4
                  letusgo,

                  Are you sure that you are using v. 0.0.13? See this response to a thread about this issue from last year. (Hint, try searching the forum first, your question may already have been answered.) Using v. 0.0.13 and the '-Q 33' option together should work. If it doesn't then your FASTQ file may be malformed.

                  Comment


                  • #10
                    Originally posted by mgogol View Post
                    I always thought it was -Q33... Does -Q 33 work?

                    [edit] Oh, yes, it does.
                    unfortunately,it doesn't work for my fastq files,then i convert the sanger fastq to illumina fastq.when i run fastq_quality_filter,another error :

                    fastq_quality_filter: Invalid quality score value (char 'i' ord 105 quality value 41) on line 4

                    Comment


                    • #11
                      Originally posted by letusgo View Post
                      @hwi-st298:170:81mg3abxx:1:1101:1349:2455 1:n:0:ttaggc
                      ctggttcagccttcttaggctcttcttctgtttccttacctcagatcggaagagcacacgtctgaactccagtcacttaggcatttcgtatgacgtatgt
                      +
                      cccfffffghghfhgiijjfhegi?fhiihfchggggcegggicgebchfhgdhgiiibaf@fh7@@e;7=a;aadd>ccbcca################
                      @hwi-st298:170:81mg3abxx:1:1101:1372:2461 1:n:0:ttaggc
                      agacggtgttgcataagctgttgtatctgttgctgttgaaactgaaactgctgctgttgctgcttttgttttttagatcggcagggcacacgtgtgcgac
                      +
                      @@@fff@dfhgff<gaeehggg@@ehafhiiibgg<?ff<?<bf<fg@gg?be<<3?88bf#######################################
                      @hwi-st298:170:81mg3abxx:1:1101:1866:2486 1:n:0:ttaggc
                      gtcactttgtacctcttctcaaattaggaaaatacgaagttcgaggaacgcctttcgttctctttttttcttggtcggcagggtcagggcctttcttgct
                      +
                      @@cdffffdddhhegeggeegeh>hhhiigiij>ffcgggeghid0?dfdfggiig1=;;ceggcac<<ce@a@>>>;??>95(9<(38<?<a#######
                      O.K. I missed this before. Clearly your quality lines are malformed; are these after you converted them? You have ASCII values ranging from 35 (#) to 105 (i). No valid FASTQ files for Illumina reads uses a range this wide.

                      Comment


                      • #12
                        Originally posted by kmcarr View Post
                        O.K. I missed this before. Clearly your quality lines are malformed; are these after you converted them? You have ASCII values ranging from 35 (#) to 105 (i). No valid FASTQ files for Illumina reads uses a range this wide.
                        they come from a seqencing company,i didn't convert them.but when i convert them to Illumina fastq,their ASCII values is also malformed,what can i do?

                        Comment


                        • #13
                          Originally posted by letusgo View Post
                          they come from a seqencing company,i didn't convert them.but when i convert them to Illumina fastq,their ASCII values is also malformed,what can i do?
                          Ask the company what they did to create such data..?

                          Comment


                          • #14
                            Just curious, I googled the unique machine id: hwi-st298.
                            And I found this:
                            http://seqanswers.com/forums/showthread.php?t=15928
                            It looks that the company triggered the malformation not the first time.
                            Which company it is? BGI?

                            Comment

                            Latest Articles

                            Collapse

                            • seqadmin
                              Latest Developments in Precision Medicine
                              by seqadmin



                              Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

                              Somatic Genomics
                              “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
                              05-24-2024, 01:16 PM
                            • seqadmin
                              Recent Advances in Sequencing Analysis Tools
                              by seqadmin


                              The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
                              05-06-2024, 07:48 AM

                            ad_right_rmr

                            Collapse

                            News

                            Collapse

                            Topics Statistics Last Post
                            Started by seqadmin, 05-24-2024, 07:15 AM
                            0 responses
                            123 views
                            0 likes
                            Last Post seqadmin  
                            Started by seqadmin, 05-23-2024, 10:28 AM
                            0 responses
                            136 views
                            0 likes
                            Last Post seqadmin  
                            Started by seqadmin, 05-23-2024, 07:35 AM
                            0 responses
                            135 views
                            0 likes
                            Last Post seqadmin  
                            Started by seqadmin, 05-22-2024, 02:06 PM
                            0 responses
                            11 views
                            0 likes
                            Last Post seqadmin  
                            Working...
                            X