Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Hena
    Member
    • Nov 2009
    • 19

    SeqPrep and discarding reads

    I've been testing SeqPrep (http://seqanswers.com/wiki/SeqPrep) for trimming adapters and merging reads. However I'm unsure why some reads get discarded. The command line is as follows:

    SeqPrep -f s_5_1_sequence.txt.gz -r s_5_2_sequence.txt.gz -1 s_5_1-trimmed.fastq.gz -2 s_5_2-trimmed.fastq.gz -A AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -B AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT -s merged.fastq.gz -L 1 -6 -E alignment.txt.gz

    I'm assuming -L 1 would prevent removal of any reads (the help on command line differs abit from the wiki page). However reads still get removed. What causes this and what should I do to affect this?
  • jp.
    Senior Member
    • Jul 2013
    • 142

    #2
    any solution did you get ?

    Comment

    • Hena
      Member
      • Nov 2009
      • 19

      #3
      I found an answer to why it does discard reads even after minimum length.

      First off, awesome bit of software. I recently went looking for something that does exactly what your code does. I was very happy to find it. To the point-- It seems that SeqPrep will discard read ...


      Edit: If SeqPrep matches adapters but fails to do proper merge of reads, then it discards the reads. I suppose it would be possible to make a patch to prevent this functionality.
      Last edited by Hena; 08-18-2013, 11:29 PM.

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Nine Things a Sample Prep Scientist Thinks About Before Sequencing
        by SEQadmin2


        I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.


        Here are nine questions we think about, in roughly the order they matter, before...
        Today, 07:11 AM
      • SEQadmin2
        From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
        by SEQadmin2


        Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


        The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
        ...
        06-02-2026, 10:05 AM
      • SEQadmin2
        Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
        by SEQadmin2


        With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


        Introduction

        Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
        05-22-2026, 06:42 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, Yesterday, 06:09 AM
      0 responses
      16 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 06-09-2026, 11:58 AM
      0 responses
      37 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 06-05-2026, 10:09 AM
      0 responses
      42 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 06-04-2026, 08:59 AM
      0 responses
      49 views
      0 reactions
      Last Post SEQadmin2  
      Working...