Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Hena
    Member
    • Nov 2009
    • 19

    SeqPrep and discarding reads

    I've been testing SeqPrep (http://seqanswers.com/wiki/SeqPrep) for trimming adapters and merging reads. However I'm unsure why some reads get discarded. The command line is as follows:

    SeqPrep -f s_5_1_sequence.txt.gz -r s_5_2_sequence.txt.gz -1 s_5_1-trimmed.fastq.gz -2 s_5_2-trimmed.fastq.gz -A AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC -B AGATCGGAAGAGCGTCGTGTAGGGAAAGAGT -s merged.fastq.gz -L 1 -6 -E alignment.txt.gz

    I'm assuming -L 1 would prevent removal of any reads (the help on command line differs abit from the wiki page). However reads still get removed. What causes this and what should I do to affect this?
  • jp.
    Senior Member
    • Jul 2013
    • 142

    #2
    any solution did you get ?

    Comment

    • Hena
      Member
      • Nov 2009
      • 19

      #3
      I found an answer to why it does discard reads even after minimum length.

      First off, awesome bit of software. I recently went looking for something that does exactly what your code does. I was very happy to find it. To the point-- It seems that SeqPrep will discard read ...


      Edit: If SeqPrep matches adapters but fails to do proper merge of reads, then it discards the reads. I suppose it would be possible to make a patch to prevent this functionality.
      Last edited by Hena; 08-18-2013, 11:29 PM.

      Comment

      Latest Articles

      Collapse

      • mylaser
        Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by mylaser
        Kheloyar – Everything You Need to Know About Kheloyaar Login and Kheoyar Id
        If you are looking for an online gaming platform that offers a user-friendly experience, Kheloyar has become a name that many users search for. Whether you're interested in creating a new account, accessing your dashboard through Kheloyaar Login, or learning how to obtain a Kheoyar Id, understanding the platform's features and account process is essential.
        This guide explains everything you need to know about...
        Today, 01:13 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-09-2026, 10:04 AM
      0 responses
      17 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-08-2026, 10:08 AM
      0 responses
      10 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-07-2026, 11:05 AM
      0 responses
      22 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-02-2026, 11:08 AM
      0 responses
      31 views
      0 reactions
      Last Post SEQadmin2  
      Working...