- With the version 2 of tophat I get an '*' as quality sequences in the bam file for more that 70% of the reads.
Ex:
Read 1
GCCCTCGCGGTGCTCTCCGGGTCTGTGCTGAGGAGAACGCAACTCCGCCG DDDDDDDFFFGHHHJJIJIJIIIJJIGGHIGJJJJJJHGHHHFFFFFCC@
Read 2
GGCGTGTGTTGC *
Read 3
CCGGCCCTCGCTCCAGCAGCTGGACCCCTACCTGCCGTCTGCTGC *
Read 4
CAACTGCTGGCCTGTGCCAGGGTGCAAGCTGAGCACTGGAGTGGAGTTTTC C@CFFFFFHGHHHIGHJJIIJICEHIGIIIIGHJGIJJJBGDFGGHHIIIH
The bam file for this same sample with tophat 1.4 is ok.
Has someone encountered this problem? THank you
-
-
Why are your read lengths different. Looks like the two that are the same size have proper quality strings -
I encountered the same problem.
Problem was alleviated by switching back to 1.4.1.Comment
-
My reads were filtered for quality. But the same problems happens without filtering. And version 1.4 corrects the problem as mentionned by pzumbo.Comment
-
I'm having the same issue with tophat2. I just posted over here: http://seqanswers.com/forums/showpos...66&postcount=4Comment
-
I had the same problem when running tophat2 with bowtie2. However, I did not see this issue after running tophat2 with the --bowtie1 option. Thus, it might be problem with bowtie2.Comment
-
NGS has revolutionized clinical microbiology by offering new ways to identify and surveil pathogens without prior knowledge of the target. One popular approach is 16S rRNA and ITS amplicon sequencing, which targets specific microbial markers. But studies are increasingly incorporating shotgun metagenomics, a technique that sequences all DNA from a sample without targeting specific microbial markers. This approach allows more detailed taxonomic classification, detection...Today, 06:46 AM -
Tumors contain complex mixtures of cell populations that evolve in response to treatment and host-specific factors. Tissue biopsies provide only static snapshots of a tumor’s state. But what if we could follow that evolution over time using a minimally invasive technique?
Liquid biopsies can detect tumor-derived material circulating in the bloodstream, providing a way to study treatment response, detect emerging resistance, and discover new biomarkers. Circulating...10-14-2026, 09:55 AM
Comment