Header Leaderboard Ad

Collapse

SAM file flag problem

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • SAM file flag problem

    Hi all,
    Is any body know what's the the flag means in the SAM file.
    The Flag I got looks different with the SAM manual.

    Thanks!

    Here is a sample of my sam file.

    HWI-EAS283:8:1:1:695#0 69 * 0 0 * * 0 0 NACAAGGCATTGTTGTTGCTATCATTGCTTGCAAGCAGGAATNGCTAATGGAAGACTTCTTTTTTTTTGTGTACTT %/:56465,577-91-265//:######################################################
    HWI-EAS283:8:1:1:695#0 133 * 0 0 * * 0 0 AAANCGCTACGTAATGATTGCAGTGAGCACAGAGCGCCCTACTGCACTCCAGCCTGGGAAACAGAGCGCGATTCCG ############################################################################
    HWI-EAS283:8:1:1:749#0 99 chr7 91549950 37 76M = 91550245 354 NACCTATCTTAATTACGTTTCAAAGTATATACTCTTTTATAANAAATGAGCTCCATAACTTAAAAGCTAGATAACA %0:<;;9::7779<;;99979707999;::9:;::9:<<75.%*5789197978599################### XT:A:U NM:i:3 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:3 XO:i:0 XG:i:0 MD:Z:0T41C31A1
    HWI-EAS283:8:1:1:749#0 147 chr7 91550245 37 17S59M = 91549950 -354 ATTGTGTTAGACCGTGAGTCCATAAAAATATATAGAGGTAATCTGTGGGCGTTTAGTAAATGGTGGTCCTACNACT #####################################################################B6>%42B XT:A:M NM:i:12 SM:i:37 AM:i:37 XM:i:12 XO:i:0 XG:i:0 MD:Z:2A4C9T1T4A5A6C0T0G5T1T0T6T3
    HWI-EAS283:8:1:1:1047#0 69 * 0 0 * * 0 0 NTTTTTTGTTCCTTTTTTTTCAAGAGGCCAGAGGCAGAGGCCNTTGTCATTTTCTGTGTGTCCAGGTAATTGCGTA %1:::98789:::999:::::985226#################################################
    HWI-EAS283:8:1:1:1047#0 133 * 0 0 * * 0 0 ACCNCGCCTGCCGAGTTTTTCCTTTCTATATTCTTAGTCGTTAAGAATGTTCTATCATGTTGTAATTTTTGTAGTC 0###########################################################################

  • #2
    Originally posted by ptong7 View Post
    Hi all,
    Is any body know what's the the flag means in the SAM file.
    The Flag I got looks different with the SAM manual.

    Thanks!

    Here is a sample of my sam file.

    HWI-EAS283:8:1:1:695#0 69 * 0 0 * * 0 0 NACAAGGCATTGTTGTTGCTATCATTGCTTGCAAGCAGGAATNGCTAATGGAAGACTTCTTTTTTTTTGTGTACTT %/:56465,577-91-265//:######################################################
    HWI-EAS283:8:1:1:695#0 133 * 0 0 * * 0 0 AAANCGCTACGTAATGATTGCAGTGAGCACAGAGCGCCCTACTGCACTCCAGCCTGGGAAACAGAGCGCGATTCCG ############################################################################
    HWI-EAS283:8:1:1:749#0 99 chr7 91549950 37 76M = 91550245 354 NACCTATCTTAATTACGTTTCAAAGTATATACTCTTTTATAANAAATGAGCTCCATAACTTAAAAGCTAGATAACA %0:<;;9::7779<;;99979707999;::9:;::9:<<75.%*5789197978599################### XT:A:U NM:i:3 SM:i:37 AM:i:37 X0:i:1 X1:i:0 XM:i:3 XO:i:0 XG:i:0 MD:Z:0T41C31A1
    HWI-EAS283:8:1:1:749#0 147 chr7 91550245 37 17S59M = 91549950 -354 ATTGTGTTAGACCGTGAGTCCATAAAAATATATAGAGGTAATCTGTGGGCGTTTAGTAAATGGTGGTCCTACNACT #####################################################################B6>%42B XT:A:M NM:i:12 SM:i:37 AM:i:37 XM:i:12 XO:i:0 XG:i:0 MD:Z:2A4C9T1T4A5A6C0T0G5T1T0T6T3
    HWI-EAS283:8:1:1:1047#0 69 * 0 0 * * 0 0 NTTTTTTGTTCCTTTTTTTTCAAGAGGCCAGAGGCAGAGGCCNTTGTCATTTTCTGTGTGTCCAGGTAATTGCGTA %1:::98789:::999:::::985226#################################################
    HWI-EAS283:8:1:1:1047#0 133 * 0 0 * * 0 0 ACCNCGCCTGCCGAGTTTTTCCTTTCTATATTCTTAGTCGTTAAGAATGTTCTATCATGTTGTAATTTTTGTAGTC 0###########################################################################
    Typically, the flag field is converted to an integer value for display. You will have to infer the bits set by their sum. In the newest trunk code, you can use "samtools view" with either the "-x" or "-X" for better viewing (C code only).

    Comment


    • #3
      Hi nilshomer,
      I try "samtools view -x aln.sorted.bam <region>".
      but I got this "view: illegal option -- x"

      Comment


      • #4
        Did you download the latest developers version from the trunk (not the release)?

        Comment


        • #5
          Thanks nilshomer, It works...

          Comment


          • #6
            it's been a long time but the problem i had is the same happy wheels unblocked

            Comment


            • #7
              If an application crashes, or if you want to install a new version of an application and force it to replace the old version, then that can lead to problems with the SAM.
              drift hunters 5 letter words
              Last edited by donna1205; 08-24-2022, 06:11 PM.

              Comment

              Latest Articles

              Collapse

              • seqadmin
                A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
                by seqadmin


                ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

                01-24-2023, 01:19 PM
              • seqadmin
                Introduction to Single-Cell Sequencing
                by seqadmin
                Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

                The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
                ...
                01-09-2023, 03:10 PM

              ad_right_rmr

              Collapse
              Working...
              X