Seqanswers Leaderboard Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • fanping
    Junior Member
    • Sep 2011
    • 9

    flag inside sam file

    I got a read aligned as below:
    HWI-1KL138:2:2105:12847:125331#GCCAATGCCAAT 161 chr1 12036 1 74M = 12645 1188 CTGTGCCAGGGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGG hhhhhhhhhhhghhhhhhhhhhhhhhhhhheffffdffffhhhghhehefhhhhhghhfhfffWdbfffbffff NM:i:0 NH:i:3 CC:Z:chr15 CP:i:102519061 HI:i:0

    The flag here is 161=128+32+1. 128 means 2nd pair; 32 means mated reverse strand; 1 means paired read. I am wondering why there is no information about the alignment in this flag. The alignment info can be either both aligned, read unmapped, mate unmapped indicated by 0x2, 0x4, 0x8 in sam files. Thanks advance for any answer or comment.

    fanping
  • swbarnes2
    Senior Member
    • May 2008
    • 910

    #2
    The lack of 4 and 8 means that both aligned.

    The 2 flag means "properly paired", not "both aligned". That means not only did both ends map, but that their orientation and distance is what the software was expecting. Your reads are more than a kb apart. This may be why the software didn't think they were properly paired.

    Comment

    • fanping
      Junior Member
      • Sep 2011
      • 9

      #3
      Thanks. It makes sense.

      fanping
      Originally posted by swbarnes2 View Post
      The lack of 4 and 8 means that both aligned.

      The 2 flag means "properly paired", not "both aligned". That means not only did both ends map, but that their orientation and distance is what the software was expecting. Your reads are more than a kb apart. This may be why the software didn't think they were properly paired.

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Pathogen Surveillance with Advanced Genomic Tools
        by seqadmin




        The COVID-19 pandemic highlighted the need for proactive pathogen surveillance systems. As ongoing threats like avian influenza and newly emerging infections continue to pose risks, researchers are working to improve how quickly and accurately pathogens can be identified and tracked. In a recent SEQanswers webinar, two experts discussed how next-generation sequencing (NGS) and machine learning are shaping efforts to monitor viral variation and trace the origins of infectious...
        Yesterday, 11:48 AM
      • seqadmin
        New Genomics Tools and Methods Shared at AGBT 2025
        by seqadmin


        This year’s Advances in Genome Biology and Technology (AGBT) General Meeting commemorated the 25th anniversary of the event at its original venue on Marco Island, Florida. While this year’s event didn’t include high-profile musical performances, the industry announcements and cutting-edge research still drew the attention of leading scientists.

        The Headliner
        The biggest announcement was Roche stepping back into the sequencing platform market. In the years since...
        03-03-2025, 01:39 PM
      • seqadmin
        Investigating the Gut Microbiome Through Diet and Spatial Biology
        by seqadmin




        The human gut contains trillions of microorganisms that impact digestion, immune functions, and overall health1. Despite major breakthroughs, we’re only beginning to understand the full extent of the microbiome’s influence on health and disease. Advances in next-generation sequencing and spatial biology have opened new windows into this complex environment, yet many questions remain. This article highlights two recent studies exploring how diet influences microbial...
        02-24-2025, 06:31 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 03-20-2025, 05:03 AM
      0 responses
      26 views
      0 reactions
      Last Post seqadmin  
      Started by seqadmin, 03-19-2025, 07:27 AM
      0 responses
      33 views
      0 reactions
      Last Post seqadmin  
      Started by seqadmin, 03-18-2025, 12:50 PM
      0 responses
      25 views
      0 reactions
      Last Post seqadmin  
      Started by seqadmin, 03-03-2025, 01:15 PM
      0 responses
      190 views
      0 reactions
      Last Post seqadmin  
      Working...