Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • fanping
    Junior Member
    • Sep 2011
    • 9

    flag inside sam file

    I got a read aligned as below:
    HWI-1KL138:2:2105:12847:125331#GCCAATGCCAAT 161 chr1 12036 1 74M = 12645 1188 CTGTGCCAGGGTGCAAGCTGAGCACTGGAGTGGAGTTTTCCTGTGGAGAGGAGCCATGCCTAGAGTGGGATGGG hhhhhhhhhhhghhhhhhhhhhhhhhhhhheffffdffffhhhghhehefhhhhhghhfhfffWdbfffbffff NM:i:0 NH:i:3 CC:Z:chr15 CP:i:102519061 HI:i:0

    The flag here is 161=128+32+1. 128 means 2nd pair; 32 means mated reverse strand; 1 means paired read. I am wondering why there is no information about the alignment in this flag. The alignment info can be either both aligned, read unmapped, mate unmapped indicated by 0x2, 0x4, 0x8 in sam files. Thanks advance for any answer or comment.

    fanping
  • swbarnes2
    Senior Member
    • May 2008
    • 910

    #2
    The lack of 4 and 8 means that both aligned.

    The 2 flag means "properly paired", not "both aligned". That means not only did both ends map, but that their orientation and distance is what the software was expecting. Your reads are more than a kb apart. This may be why the software didn't think they were properly paired.

    Comment

    • fanping
      Junior Member
      • Sep 2011
      • 9

      #3
      Thanks. It makes sense.

      fanping
      Originally posted by swbarnes2 View Post
      The lack of 4 and 8 means that both aligned.

      The 2 flag means "properly paired", not "both aligned". That means not only did both ends map, but that their orientation and distance is what the software was expecting. Your reads are more than a kb apart. This may be why the software didn't think they were properly paired.

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-20-2026, 11:10 AM
      0 responses
      9 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-13-2026, 10:26 AM
      0 responses
      30 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-09-2026, 10:04 AM
      0 responses
      41 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-08-2026, 10:08 AM
      0 responses
      26 views
      0 reactions
      Last Post SEQadmin2  
      Working...