Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Tophat 2.0.3: Warnings

    Hi all,

    I am completely new to tophat. It seems that it did not run properly as it generated two warning messages and all bed files were empty (including deletions, insertions and junctions). In addition, the size of the accepted_hit.bam file is only 250kb while the unmapped.bam is 1.1GB. For details, please see the code below.

    It would be very appreciated if anyone could help me solve these issues:
    1) Why is the junction database empty? (Waring1)
    2) How to remove all temporary files? (Warning2)
    3) Why are the bed files empty?
    4) Why are there so many reads unmapped?

    Thanks!

    Code:
    tophat --bowtie1 --color --segment-length 13 -o /home/usr/Download/Data2 hg18 /home/usr/Download/Sample_R3.csfasta.txt
    [2012-06-11 19:33:18] Beginning TopHat run (v2.0.3)
    -----------------------------------------------
    [2012-06-11 19:33:18] Checking for Bowtie
                      Bowtie version:        0.12.8.0
    [2012-06-11 19:33:18] Checking for Samtools
                    Samtools version:        0.1.18.0
    [2012-06-11 19:33:18] Checking for Bowtie index files
    [2012-06-11 19:33:18] Checking for reference FASTA file
    [2012-06-11 19:33:18] Generating SAM header for hg18
            format:          fasta
    [2012-06-11 19:33:18] Preparing reads
             left reads: min. length=25, max. length=25, 81854203 kept reads (0 discarded)
    [2012-06-11 19:49:15] Mapping left_kept_reads to genome hg18 with Bowtie 
    [COLOR="Red"]Warning: junction database is empty![/COLOR]
    [2012-06-11 19:51:52] Reporting output tracks
    [COLOR="Red"]Warning: couldn't remove all temporary files in /home/usr/Download/Data2/tmp/[/COLOR]
    -----------------------------------------------
    [2012-06-11 20:21:16] Run complete: 00:47:58 elapsed

  • #2
    Hello,

    I have the same problem. My command is :

    Code:
    tophat -p 4 --genome-read-mismatches 3 --read-mismatches 3 --max-multihits 1 --b2-sensitive hg19 /home/darstr/tmp/ArrayStarProbes.fa
    The sequences in the FASTA are microarray probes either 60 or 61 bases long, some designed across splice junctions. I'm mapping them with TopHat to re-annotate them.

    Code:
    $ head /home/darstr/tmp/ArrayStarProbes.fa
    >CUST_385_PI426073487
    ACTTGTTTCAGGTTAATGGTAAGAGTTACCCGCAGGCTAAGTTGCTATTGGGACAGATGG
    >ASHG19A3A032313
    GAAACATCTTCCCAGAAAACAGACTACAACAAATCATTTCCCTGGTATGAAGGAATGAAG
    >ASHG19A3L0000337
    AGATATCTGGTTGAGACCAAGTAAGAGATAAACCTGTAGATTCCACTGTGCCACCACAGT
    >ASHG19A3A014810
    GGACAAGAATCCTTCAAAAAACAGGAAAAAACTCCTAAAACACCTAAAAGGACCTAGTTC
    >ASHG19A3A015967
    AAGATCTTCATAGAAAGAGTCCAGGGGAACCCAACCCTATTGCACATCACAGATCTTCAG
    I get 0 successfully mapped sequences.

    Code:
    $ samtools view -c tophat_out/accepted_hits.bam
    0
    I know there's quite a few uniquely mapping perfectly matching probes on the array.

    I got the same 2 warning messages from my run as the original poster. I hope a new TopHat version is released soon.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Advanced Tools Transforming the Field of Cytogenomics
      by seqadmin


      At the intersection of cytogenetics and genomics lies the exciting field of cytogenomics. It focuses on studying chromosomes at a molecular scale, involving techniques that analyze either the whole genome or particular DNA sequences to examine variations in structure and behavior at the chromosomal or subchromosomal level. By integrating cytogenetic techniques with genomic analysis, researchers can effectively investigate chromosomal abnormalities related to diseases, particularly...
      09-26-2023, 06:26 AM
    • seqadmin
      How RNA-Seq is Transforming Cancer Studies
      by seqadmin



      Cancer research has been transformed through numerous molecular techniques, with RNA sequencing (RNA-seq) playing a crucial role in understanding the complexity of the disease. Maša Ivin, Ph.D., Scientific Writer at Lexogen, and Yvonne Goepel Ph.D., Product Manager at Lexogen, remarked that “The high-throughput nature of RNA-seq allows for rapid profiling and deep exploration of the transcriptome.” They emphasized its indispensable role in cancer research, aiding in biomarker...
      09-07-2023, 11:15 PM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 09-29-2023, 09:38 AM
    0 responses
    10 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 09-27-2023, 06:57 AM
    0 responses
    12 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 09-26-2023, 07:53 AM
    0 responses
    30 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 09-25-2023, 07:42 AM
    0 responses
    17 views
    0 likes
    Last Post seqadmin  
    Working...
    X