Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Dario1984
    replied
    Hello,

    I have the same problem. My command is :

    Code:
    tophat -p 4 --genome-read-mismatches 3 --read-mismatches 3 --max-multihits 1 --b2-sensitive hg19 /home/darstr/tmp/ArrayStarProbes.fa
    The sequences in the FASTA are microarray probes either 60 or 61 bases long, some designed across splice junctions. I'm mapping them with TopHat to re-annotate them.

    Code:
    $ head /home/darstr/tmp/ArrayStarProbes.fa
    >CUST_385_PI426073487
    ACTTGTTTCAGGTTAATGGTAAGAGTTACCCGCAGGCTAAGTTGCTATTGGGACAGATGG
    >ASHG19A3A032313
    GAAACATCTTCCCAGAAAACAGACTACAACAAATCATTTCCCTGGTATGAAGGAATGAAG
    >ASHG19A3L0000337
    AGATATCTGGTTGAGACCAAGTAAGAGATAAACCTGTAGATTCCACTGTGCCACCACAGT
    >ASHG19A3A014810
    GGACAAGAATCCTTCAAAAAACAGGAAAAAACTCCTAAAACACCTAAAAGGACCTAGTTC
    >ASHG19A3A015967
    AAGATCTTCATAGAAAGAGTCCAGGGGAACCCAACCCTATTGCACATCACAGATCTTCAG
    I get 0 successfully mapped sequences.

    Code:
    $ samtools view -c tophat_out/accepted_hits.bam
    0
    I know there's quite a few uniquely mapping perfectly matching probes on the array.

    I got the same 2 warning messages from my run as the original poster. I hope a new TopHat version is released soon.

    Leave a comment:


  • Droplet
    started a topic Tophat 2.0.3: Warnings

    Tophat 2.0.3: Warnings

    Hi all,

    I am completely new to tophat. It seems that it did not run properly as it generated two warning messages and all bed files were empty (including deletions, insertions and junctions). In addition, the size of the accepted_hit.bam file is only 250kb while the unmapped.bam is 1.1GB. For details, please see the code below.

    It would be very appreciated if anyone could help me solve these issues:
    1) Why is the junction database empty? (Waring1)
    2) How to remove all temporary files? (Warning2)
    3) Why are the bed files empty?
    4) Why are there so many reads unmapped?

    Thanks!

    Code:
    tophat --bowtie1 --color --segment-length 13 -o /home/usr/Download/Data2 hg18 /home/usr/Download/Sample_R3.csfasta.txt
    [2012-06-11 19:33:18] Beginning TopHat run (v2.0.3)
    -----------------------------------------------
    [2012-06-11 19:33:18] Checking for Bowtie
                      Bowtie version:        0.12.8.0
    [2012-06-11 19:33:18] Checking for Samtools
                    Samtools version:        0.1.18.0
    [2012-06-11 19:33:18] Checking for Bowtie index files
    [2012-06-11 19:33:18] Checking for reference FASTA file
    [2012-06-11 19:33:18] Generating SAM header for hg18
            format:          fasta
    [2012-06-11 19:33:18] Preparing reads
             left reads: min. length=25, max. length=25, 81854203 kept reads (0 discarded)
    [2012-06-11 19:49:15] Mapping left_kept_reads to genome hg18 with Bowtie 
    [COLOR="Red"]Warning: junction database is empty![/COLOR]
    [2012-06-11 19:51:52] Reporting output tracks
    [COLOR="Red"]Warning: couldn't remove all temporary files in /home/usr/Download/Data2/tmp/[/COLOR]
    -----------------------------------------------
    [2012-06-11 20:21:16] Run complete: 00:47:58 elapsed

Latest Articles

Collapse

  • seqadmin
    Exploring the Dynamics of the Tumor Microenvironment
    by seqadmin




    The complexity of cancer is clearly demonstrated in the diverse ecosystem of the tumor microenvironment (TME). The TME is made up of numerous cell types and its development begins with the changes that happen during oncogenesis. “Genomic mutations, copy number changes, epigenetic alterations, and alternative gene expression occur to varying degrees within the affected tumor cells,” explained Andrea O’Hara, Ph.D., Strategic Technical Specialist at Azenta. “As...
    07-08-2024, 03:19 PM
  • seqadmin
    Exploring Human Diversity Through Large-Scale Omics
    by seqadmin


    In 2003, researchers from the Human Genome Project (HGP) announced the most comprehensive genome to date1. Although the genome wasn’t fully completed until nearly 20 years later2, numerous large-scale projects, such as the International HapMap Project and 1000 Genomes Project, continued the HGP's work, capturing extensive variation and genomic diversity within humans. Recently, newer initiatives have significantly increased in scale and expanded beyond genomics, offering a more detailed...
    06-25-2024, 06:43 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 06:53 AM
0 responses
11 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-10-2024, 07:30 AM
0 responses
32 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 09:45 AM
0 responses
203 views
0 likes
Last Post seqadmin  
Started by seqadmin, 07-03-2024, 08:54 AM
0 responses
213 views
0 likes
Last Post seqadmin  
Working...
X