Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • bioinfosm
    Senior Member
    • Jan 2008
    • 483

    #16
    what would a flag 0 imply in sam output? I used novo align and the only flags I see are 0 4 and 16. 4 is unmapped read. 16 is for the strand, but how to interpret 0.

    Also, How can I ascertain the reads that are *not* uniquely mapped. I read that the 5th column MAPQ should be of help to determine multiply-mapped reads. Is MAPQ=0 an indication that the read is multiply-mapped?

    Thanks
    --
    bioinfosm

    Comment

    • totalnew
      Member
      • Apr 2009
      • 46

      #17
      Originally posted by bioinfosm View Post
      what would a flag 0 imply in sam output? I used novo align and the only flags I see are 0 4 and 16. 4 is unmapped read. 16 is for the strand, but how to interpret 0.

      Also, How can I ascertain the reads that are *not* uniquely mapped. I read that the 5th column MAPQ should be of help to determine multiply-mapped reads. Is MAPQ=0 an indication that the read is multiply-mapped?

      Thanks
      Flag 0 means "the read is not paired and mapped, forward strand"

      You are right, MAPQ =0 is an indication that this read has multiple best hits, which means it is not unique match.

      Comment

      • yxi
        Junior Member
        • Apr 2009
        • 6

        #18
        Actually, I always have the question why SAM format using a binary FLAG field instead of text/char field to indicate the mapping status. IMHO a human readable FLAG field would make much more sense, and maybe the strand information could be listed as a separated field. It's also a headache to look at those aux fields. Excuse me but I have the feeling that SAM format is somewhat over complicated, is there any possibility the SAM format could be modified so that people could read it more easily?

        Thanks.

        Comment

        • lh3
          Senior Member
          • Feb 2008
          • 686

          #19
          @yxi

          Please use "samtools view -X" to see a human readable FLAG. I agree that not specifying a better FLAG field initially is a shortcoming, but it is too late to change the spec at the moment. samtools view -X comes as a temporary hack which I find useful.

          Could you suggest a better format for the aux fields or to make SAM simpler? Note that SAM should be both human readable and machine readable. The current form is the best we can come to so far. Genbank/EMBL files are human readable, but they cause a lot of troubles in parsing, and we do not want to go in that way again. I think the best solution to human readability is not to change the spec, but to write a script to print a SAM alignment in multiple lines in a beautiful way. If you want to contribute to such a script, that would be great. Thanks.

          Comment

          • totalnew
            Member
            • Apr 2009
            • 46

            #20
            Currently in most of sam/bam files, the header is empty. However, this could potentially be a good place to store all the info people are interested. From the SAM format specification, HEADER SECTION has four default record types - @HD, @SQ, @RG, @RG.
            Can we define our own record type, such as @MN.... or it won't be recognized by samtools.

            In addition, each record type has predefined data field, such as VN, SO, GO in @HD. Can we add more data field?

            thanks

            Comment

            • Nix
              Member
              • Jun 2008
              • 60

              #21
              Wow, the more I dig into sam the more it looks like a horse put together by a committee. These bit flags are ridiculous for a human readable text alignment format.

              Comment

              • nilshomer
                Nils Homer
                • Nov 2008
                • 1283

                #22
                Originally posted by Nix View Post
                Wow, the more I dig into sam the more it looks like a horse put together by a committee. These bit flags are ridiculous for a human readable text alignment format.
                It was put together by a committee. The flag field, in my opinion, is left over from the internal C representation, which was created for compactness (then compressed into SAM). You will encounter the internal format if you program using the SAMTools C API but nonetheless the internal (compact) data structure should not have been shown to the user when viewing SAM (not BAM files). Just wait until you try to get anything clarified/changed/included in the specification.

                Nils

                Comment

                • lh3
                  Senior Member
                  • Feb 2008
                  • 686

                  #23
                  If SAM were designed by one person, it would not be widely accepted. There are pros and cons. As to the bit flag, have you tried "samtools view -X"?

                  Comment

                  • drio
                    Senior Member
                    • Oct 2008
                    • 323

                    #24
                    I particularly like the TCGA BAM specification for the BAM headers. It uses most of the header types and their associated tags to capture things like: sequencing platform, reference contig details(MD5s, url..), samples, institution, library, etc...
                    -drd

                    Comment

                    • nilshomer
                      Nils Homer
                      • Nov 2008
                      • 1283

                      #25
                      Originally posted by lh3 View Post
                      If SAM were designed by one person, it would not be widely accepted. There are pros and cons. As to the bit flag, have you tried "samtools view -X"?
                      It is widely accepted because good tools (i.e. lh3's implementation in SAMTools and now Picard) were available early and was used by the first major sequencing efforts (aka 1000 Genomes). I no way mean to lambaste the creators of SAM, only to be honest about its development and implementation.

                      Comment

                      • Nix
                        Member
                        • Jun 2008
                        • 60

                        #26
                        OK, 4hrs later and I can parse the strand.....

                        Here's some java code so folks don't have to go through this again:

                        <pre>
                        /**
                        * Index Index^2 MethodName Flag DescriptionFromSamSpec
                        * 0 1 isReadPartOfAPairedAlignment 0x0001 the read is paired in sequencing, no matter whether it is mapped in a pair
                        * 1 2 isReadAProperPairedAlignment 0x0002 the read is mapped in a proper pair (depends on the protocol, normally inferred during alignment) 1
                        * 2 4 isQueryUnmapped 0x0004 the query sequence itself is unmapped
                        * 3 8 isMateUnMapped 0x0008 the mate is unmapped
                        * 4 16 isQueryReverseStrand 0x0010 strand of the query (false for forward; true for reverse strand)
                        * 5 32 isMateReverseStrand 0x0020 strand of the mate
                        * 6 64 isReadFirstPair 0x0040 the read is the first read in a pair
                        * 7 128 isReadSecondPair 0x0080 the read is the second read in a pair
                        * 8 256 isAlignmentNotPrimary 0x0100 the alignment is not primary (a read having split hits may have multiple primary alignment records)
                        * 9 512 doesReadFailVendorQC 0x0200 the read fails platform/vendor quality checks
                        * 10 1024 isReadADuplicate 0x0400 the read is either a PCR duplicate or an optical duplicate
                        */
                        public boolean testBitwiseFlag(int testValue){
                        return ((flags & testValue) == testValue);
                        }
                        /**The read is paired in sequencing, no matter whether it is mapped in a pair*/
                        public boolean isPartOfAPairedAlignment(){
                        return testBitwiseFlag(1);
                        }
                        /**The read is mapped in a proper pair (depends on the protocol, normally inferred during alignment)*/
                        public boolean isAProperPairedAlignment(){
                        return testBitwiseFlag(2);
                        }
                        /**The query sequence itself is unmapped*/
                        public boolean isUnmapped(){
                        return testBitwiseFlag(4);
                        }
                        /**The mate is unmapped*/
                        public boolean isMateUnMapped(){
                        return testBitwiseFlag(8);
                        }
                        /**Strand of the query (false for forward; true for reverse strand)*/
                        public boolean isReverseStrand(){
                        return testBitwiseFlag(16);
                        }
                        /**Strand of the mate*/
                        public boolean isMateReverseStrand(){
                        return testBitwiseFlag(32);
                        }
                        /**The read is the first read in a pair*/
                        public boolean isFirstPair(){
                        return testBitwiseFlag(64);
                        }
                        /**The read is the second read in a pair*/
                        public boolean isSecondPair(){
                        return testBitwiseFlag(128);
                        }
                        /**The alignment is not primary (a read having split hits may have multiple primary alignment records)*/
                        public boolean isNotAPrimaryAlignment(){
                        return testBitwiseFlag(265);
                        }
                        /**The read fails platform/vendor quality checks*/
                        public boolean failedQC(){
                        return testBitwiseFlag(512);
                        }
                        /**The read is either a PCR duplicate or an optical duplicate*/
                        public boolean isADuplicate(){
                        return testBitwiseFlag(1024);
                        }
                        </pre>

                        Comment

                        • nilshomer
                          Nils Homer
                          • Nov 2008
                          • 1283

                          #27
                          Originally posted by Nix View Post
                          OK, 4hrs later and I can parse the strand.....

                          Here's some java code so folks don't have to go through this again:

                          <pre>
                          /**
                          * Index Index^2 MethodName Flag DescriptionFromSamSpec
                          * 0 1 isReadPartOfAPairedAlignment 0x0001 the read is paired in sequencing, no matter whether it is mapped in a pair
                          * 1 2 isReadAProperPairedAlignment 0x0002 the read is mapped in a proper pair (depends on the protocol, normally inferred during alignment) 1
                          * 2 4 isQueryUnmapped 0x0004 the query sequence itself is unmapped
                          * 3 8 isMateUnMapped 0x0008 the mate is unmapped
                          * 4 16 isQueryReverseStrand 0x0010 strand of the query (false for forward; true for reverse strand)
                          * 5 32 isMateReverseStrand 0x0020 strand of the mate
                          * 6 64 isReadFirstPair 0x0040 the read is the first read in a pair
                          * 7 128 isReadSecondPair 0x0080 the read is the second read in a pair
                          * 8 256 isAlignmentNotPrimary 0x0100 the alignment is not primary (a read having split hits may have multiple primary alignment records)
                          * 9 512 doesReadFailVendorQC 0x0200 the read fails platform/vendor quality checks
                          * 10 1024 isReadADuplicate 0x0400 the read is either a PCR duplicate or an optical duplicate
                          */
                          public boolean testBitwiseFlag(int testValue){
                          return ((flags & testValue) == testValue);
                          }
                          /**The read is paired in sequencing, no matter whether it is mapped in a pair*/
                          public boolean isPartOfAPairedAlignment(){
                          return testBitwiseFlag(1);
                          }
                          /**The read is mapped in a proper pair (depends on the protocol, normally inferred during alignment)*/
                          public boolean isAProperPairedAlignment(){
                          return testBitwiseFlag(2);
                          }
                          /**The query sequence itself is unmapped*/
                          public boolean isUnmapped(){
                          return testBitwiseFlag(4);
                          }
                          /**The mate is unmapped*/
                          public boolean isMateUnMapped(){
                          return testBitwiseFlag(8);
                          }
                          /**Strand of the query (false for forward; true for reverse strand)*/
                          public boolean isReverseStrand(){
                          return testBitwiseFlag(16);
                          }
                          /**Strand of the mate*/
                          public boolean isMateReverseStrand(){
                          return testBitwiseFlag(32);
                          }
                          /**The read is the first read in a pair*/
                          public boolean isFirstPair(){
                          return testBitwiseFlag(64);
                          }
                          /**The read is the second read in a pair*/
                          public boolean isSecondPair(){
                          return testBitwiseFlag(128);
                          }
                          /**The alignment is not primary (a read having split hits may have multiple primary alignment records)*/
                          public boolean isNotAPrimaryAlignment(){
                          return testBitwiseFlag(265);
                          }
                          /**The read fails platform/vendor quality checks*/
                          public boolean failedQC(){
                          return testBitwiseFlag(512);
                          }
                          /**The read is either a PCR duplicate or an optical duplicate*/
                          public boolean isADuplicate(){
                          return testBitwiseFlag(1024);
                          }
                          </pre>
                          Have you tried picard for a Java API? Here's the link to the javadoc.

                          Comment

                          • Nix
                            Member
                            • Jun 2008
                            • 60

                            #28
                            Yes I did try Picard's SAMFileReader but it has a major memory management problem when trying to parse RNA-Seq data that contains alignments to chromosomes and splice junctions. These alignment files contain headers with 2.3 million splice junction 'chromosomes' that cause the SAMFileReader to quickly throw an out of memory error. The SAM format requires one '@SQ' line for each splice junction. Ouch.

                            Thus, I had to create a light weight file parser that would skip such header info. I also wanted to get a feel for whether sam could be used as a universal short read alignment format. I'm part of two projects (GenoViz and a $100M NHLBI cardiac project) that are looking to see if SAM could serve that function.

                            I should say that now I understand bitwise flags, they are a pretty clever trick for compressing a bunch of boolean flags in a binary file. For SAM spec 2 though, they should be removed from the text format.

                            Comment

                            • aurelielaugraud
                              Member
                              • Aug 2009
                              • 37

                              #29
                              Hello, still on the flag meaning ...
                              I am trying to understand those (by bwa):

                              HWI-EAS255_8282_FC30G79_PE:4:1:1:1979 69 * 0 0 * * 0 0 TAGATGGCAAAATGAACTTCCATAAANNNNNCTGTATGCTCTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN BBBBB*2??9<BA@@BBB;BBB8@=;'''''<BCCB6+?-B??;3''''''''''''''''''''''''''''''
                              HWI-EAS255_8282_FC30G79_PE:4:1:1:1979 133 * 0 0 * * 0 0 NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN '''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''''
                              ^C

                              HWI-EAS255_8282_FC30G79_PE:4:1:1:1423 69 * 0 0 * * 0 0 TACACCAAATATATATTATATGCTGTACATAATATATTAAAGTCGACCAAATATATATTATATACTGTACATAAA BBBBBBBBBBBBBBBBBBBBBBCBBBB?BBBBBBBBBCBBBBBBBBBB9;ABBBBBBBB=B=>>>BBBB?;<BB=
                              HWI-EAS255_8282_FC30G79_PE:4:1:1:1423 133 * 0 0 * * 0 0 TATACTTTGGGTATTTTGATATTTTATTTACAGTATATAATACATACTTTGGGTACTTCGATATTTTATGTGCAG BBBBCBCBBBBBBBCCBCBBBBCCBBBBBBBBBBBBCCBBCBBBBBBBBBBBBBBBB<*<BBBBBBBBB8BBBBB

                              HWI-EAS255_8282_FC30G79_PE:4:1:1:1908 69 * 0 0 * * 0 0 ATATTTTCGTTGGAAAAAAGCTCTTGTACTACAGAACAGATCCAGTTTTACGGATACGTGGCTTGAGAGGTAGAT B909B-6<'.?A;A>;6><24BBCBBB@.?*4+?+<B=22=2?42+*9?-''326B'''')3)6,'66'.3.72?
                              HWI-EAS255_8282_FC30G79_PE:4:1:1:1908 133 * 0 0 * * 0 0 AAGGGATCCATCCGACGTAGCGTCCGAAACAGTTAAGATGAGAGCACTTAGAAAACTCATCCAGCGAAGGATACA B92<?+<446'.9B;BB<4?7*4,1'?B6'39'.',<6),94;6,'=9'96=BBB.')3-<@+3),>49',B2*9

                              as I understand the flag meaning for 69, the query is unmapped, but the mate is mapped ... ????????

                              Moreover, I get some lines with MAPQ to 0 and flag to 99/147 with coherent insert size ... what could it be ??

                              Many Thanks

                              Aurélie

                              Comment

                              • aurelielaugraud
                                Member
                                • Aug 2009
                                • 37

                                #30
                                Hello again,
                                I have another question about this :
                                HWI-EAS255_8282_FC30G79_PE:4:1:402:627 97 chr4 49179087 0 75M chr21 9663639 0 GAACTGGATTCAAGCCAGTTAACTACTGGATCAAATCTGATCCTGGGCCCTGTCCCGTTTCTGTCATAACTTCTA BBB?BB>6@B<;<BBBBBB?BCBB6?BB=BB;@<B?BBBB0B6BB=BBBCBB8BBBBB;CBBB;BBB=8;BB?C? XT:A:R NM:i:2 SM:i:0 AM:i:0 X0:i:4 X1:i:7 XM:i:2 XO:i:0 XG:i:0 MD:Z:46A3G24
                                HWI-EAS255_8282_FC30G79_PE:4:1:402:627 145 chr21 9663639 37 75M chr4 49179087 0 TGGAACAGAAAATTGCTCAAGGAAACTCAGAGCTCAAAACACAAATCCATGGAGCTATGAACTCCGAGAGAGAAT @BBB?BB8BBBBBBBBB;;;CCBB?@@AB;B<BBBBBBBBBB8B@9ABBBBBBB=??BB;6'3BBBB;0=BBBBB XT:A:U NM:i:2 SM:i:37 AM:i:0 X0:i:1 X1:i:0 XM:i:2 XO:i:0 XG:i:0 MD:Z:20A40A13


                                how can one pair have a MAPQ at 37 and the other at 0 ..

                                and I have different flag value for other pairs mapped on different chr.
                                HWI-EAS255_8282_FC30G79_PE:4:1:24:1302 65 chr12 82786110 0 75M chr4 22777722 0 CACCTATGGGTGAGAATATGTGGTGTTTGGTTTTTTGTTCTTGTGATAGTTTACTGAGAATGATGATTTCCAATT BBBBBBBBBBBBB=BBA>ABBBBBBBBBBBBBCBBBBBBBCBBBBBBBBBBBBBB?+?=BBBBBBBBBBBBBBBB XT:A:R NM:i:1 SM:i:0 AM:i:0 X0:i:71 XM:i:1 XO:i:0 XG:i:0 MD:Z:8A66
                                HWI-EAS255_8282_FC30G79_PE:4:1:24:1302 129 chr4 22777722 0 75M chr12 82786110 0 TCCAAAAATGATAGACTGGATTAAGAAACTGTGGCACATATACACCATGGAATACTATGCAGCCATAAAAAATGA BCBBBBBBBBBBBBBBBBBBCCCBBBBBBBBBBBCCBBCCBCBBBBBBB?BBBBBCCBBBBBBBB;?2?BBBBBB XT:A:R NM:i:1 SM:i:0 AM:i:0 X0:i:55 XM:i:1 XO:i:0 XG:i:0 MD:Z:28A46

                                thanks
                                Aurélie

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                                  by SEQadmin2



                                  Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                                  There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                                  Today, 05:17 AM
                                • GATTACAT
                                  Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                  by GATTACAT
                                  Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
                                  07-01-2026, 11:43 AM
                                • SEQadmin2
                                  Nine Things a Sample Prep Scientist Thinks About Before Sequencing
                                  by SEQadmin2


                                  I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

                                  Here are nine questions we think about, in roughly the order they matter, before...
                                  06-18-2026, 07:11 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, Today, 10:08 AM
                                0 responses
                                5 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, Yesterday, 11:05 AM
                                0 responses
                                7 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 07-02-2026, 11:08 AM
                                0 responses
                                30 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 06-30-2026, 05:37 AM
                                0 responses
                                28 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...