Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • swbarnes2
    Senior Member
    • May 2008
    • 910

    #46
    No, that is the correct interpretation of the flags. 8 is also the flag for "mate is unmapped", which in theory, the first read should have, since it has the 4 flag for being unmapped itself. I'd guess that the 4 flag in the second read is an error, but it's hard to explain. One weirdness that I know bwa has when aligning is it concatenates separate reference sequences, so if a read crosses over two references, it's have a mapping position, and be flagged as unmapped (PICARD yells at you when it sees this), but that wouldn't seem to explain what you have there.

    And no, unmapped paired reads might not have an * in the rname. If a read is unmapped, and its mate is mapped, it's supposed to have the rname and position of its mate. That's so they will sort together. It's not a bug, it's a feature, really. The flag is supposed to show this, maybe the ISIZE field will too.

    Comment

    • shruti
      Member
      • Mar 2010
      • 35

      #47
      thank you for the reply.

      In the example of my previous msg the reads have different coordinates and so essentially they are mapped. I had also tried doing a blat of the sequence on the mouse whole genome (mm9) and both of them show multiple hits.

      Just for clarity, below are the best hits for both the reads. the latter read has many hits.
      ---------------------------------------------------------------------------------------------------
      browser details read1_flag99 50 1 50 50 100.0% 9 - 115259995 115260044 50
      browser details read1_flag99 50 1 50 50 100.0% 9 - 95326385 95326434 50
      browser details read1_flag99 50 1 50 50 100.0% X + 166650106 166650155 50
      browser details read1_flag99 50 1 50 50 100.0% 2 + 181747899 181747948 50
      browser details read1_flag99 50 1 50 50 100.0% 2 + 57481930 57481979 50

      browser details read2_flag151 50 1 50 50 100.0% 9 - 95326353 95326402 50
      browser details read2_flag151 50 1 50 50 100.0% 6 - 50997472 50997521 50
      browser details read2_flag151 50 1 50 50 100.0% 6 - 4873828 4873877 50
      browser details read2_flag151 50 1 50 50 100.0% 6 - 4874144 4874193 50



      Also I would expect that if a read is mapped & the mate pair is unmapped then the flag for the read could not be 99, it may be the values 75 / 91 / 139 / 155. but then I might be wrong.

      Just to clarify "mate reverse strand" means that the mate pair is mapped in reverse strand?

      Comment

      • stonyc
        Junior Member
        • Jan 2010
        • 1

        #48
        Flag = *?

        Hi, I am mapping 454 reads with the default bwa bwasw, and I'm mostly getting good results, but a couple have me stumped...

        I understand that the FLAG of 4, with aligned chromosomal coordinates indicates an alignment possibly spanning across multiple chromosomes.

        But, I'm also getting a few alignments like this:

        GVVGYHW01CSFZ8 * chrIII 7855436 199 139M * 0 0 GATCTGCCAAGCAACAGGCTAAGTCTCGCAATCAAGCCGTCAGAAAGTTCGCAGTCAAGGCTTAAGTGGCTTGTATTCATTGTTATCCATTCATGGACATTGTTCTGGTTCAATTTCAATGAAAATTGTTGCTTATGTT @BEEA<<552275<----/8//66B<<@BIIIIHHHIIIIIIIIIIIIHCDCHHEIEEEECCDBIEEEIIII???IIIIIIIIIHHHDDB131ABB@AA=EABACB?455;IIIIIIIIIIIIIIIIIIIIIIIHDDDI AS:i:139 XS:i:0 XF:i:3 XE:i:4 XN:i:0

        As you can see, the FLAG for this alignment is "*"... is this similar to the FLAG=4 situation described above, or something else entirely?

        Thanks...

        Comment

        • edge
          Senior Member
          • Sep 2009
          • 199

          #49
          Hi,

          Is it 16 refer to read map at reverse strand?
          Can I know which bitwise flag refer to those read that map in pair?

          Thanks.

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
            by SEQadmin2



            CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

            Despite this, “CRISPR helped turn genome editing from a specialized technique into
            ...
            07-31-2026, 11:01 AM
          • SEQadmin2
            Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
            by SEQadmin2


            Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

            The systematic characterization of the human proteome has
            ...
            07-20-2026, 11:48 AM
          • SEQadmin2
            Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
            by SEQadmin2



            Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
            ...
            07-09-2026, 11:10 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Yesterday, 07:41 AM
          0 responses
          12 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 08-03-2026, 10:13 AM
          0 responses
          30 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-31-2026, 02:55 AM
          0 responses
          39 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-24-2026, 12:17 PM
          0 responses
          26 views
          0 reactions
          Last Post SEQadmin2  
          Working...