Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • FASTQC problem on read with no sequence data

    I've had a problem with FASTQC. I get the following error:

    Code:
    Failed to process file 0618107SM.fastq
    uk.ac.bbsrc.babraham.FastQC.Sequence.SequenceFormatException: Midline 'CAAACATACAGCTTAAAAC
    AACAGACATTTATTATCTTATGGT' didn't start with '+'
    When I look at the context around CAACATACA..... I see that there is a sequence identifier but no sequence info following it.

    Code:
    @HWUSI-EAS1758R:33:64PA7AAXX:4:1:6103:1039 1:N:0:
    CTCGATCCACAAACCGCCCTTGGGGTAAACATTCGG
    +
    IIIIIIIIIIIIIIIIHIIIIIIIIEHIGHHHHIII
    @:701;5677@<5@######################
    @HWUSI-EAS1758R:33:64PA7AAXX:4:1:6397:1046 1:N:0:
    CCTTAGGTTATTTCATGCCTAGAAATGTATCCTACA
    +
    HHGHHHGHHDHHHHHH@HHHHHHHHHHGHHHHGHHG
    @HWUSI-EAS1758R:33:64PA7AAXX:4:1:6580:1044 1:N:0:
    GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA
    +
    GGGGEGDDGBHGHHHEGDGEGGD@GBB???GBGDBF
    It looks like the identifier that starts as "@:701;5677…" causes a failure at the next read. How would I get rid of these "empty" reads?

  • #2
    Originally posted by turnersd View Post
    How would I get rid of these "empty" reads?
    I think the problem is how you got these emtpy reads in the first place!? It looks like something went wrong with some processing upstream. Are you looking at a fastq file straight from the sequencing facility?

    Dario

    Comment


    • #3
      Originally posted by turnersd View Post
      I've had a problem with FASTQC.
      No, you've got a problem in your FASTQ file

      As Dario says, you'll need to track back and work out what went wrong in the creation of this file. It could be as simple as a data corruption on disk or when copying the file.

      Comment


      • #4
        Thanks, yes it's definitely a problem with the FASTQ file. It looks like whoever filtered this data before I got my hands on it was using grep to looks for flags in the identifier and pulls out 4 lines of context around it. But obviously something went very wrong. Now, I just need to hunt down the raw data. Thanks.

        Comment

        Latest Articles

        Collapse

        • seqadmin
          Latest Developments in Precision Medicine
          by seqadmin



          Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

          Somatic Genomics
          “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
          05-24-2024, 01:16 PM
        • seqadmin
          Recent Advances in Sequencing Analysis Tools
          by seqadmin


          The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
          05-06-2024, 07:48 AM

        ad_right_rmr

        Collapse

        News

        Collapse

        Topics Statistics Last Post
        Started by seqadmin, Yesterday, 01:32 PM
        0 responses
        10 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 05-24-2024, 07:15 AM
        0 responses
        199 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 05-23-2024, 10:28 AM
        0 responses
        221 views
        0 likes
        Last Post seqadmin  
        Started by seqadmin, 05-23-2024, 07:35 AM
        0 responses
        232 views
        0 likes
        Last Post seqadmin  
        Working...
        X