Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • turnersd
    replied
    Thanks, yes it's definitely a problem with the FASTQ file. It looks like whoever filtered this data before I got my hands on it was using grep to looks for flags in the identifier and pulls out 4 lines of context around it. But obviously something went very wrong. Now, I just need to hunt down the raw data. Thanks.

    Leave a comment:


  • maubp
    replied
    Originally posted by turnersd View Post
    I've had a problem with FASTQC.
    No, you've got a problem in your FASTQ file

    As Dario says, you'll need to track back and work out what went wrong in the creation of this file. It could be as simple as a data corruption on disk or when copying the file.

    Leave a comment:


  • dariober
    replied
    Originally posted by turnersd View Post
    How would I get rid of these "empty" reads?
    I think the problem is how you got these emtpy reads in the first place!? It looks like something went wrong with some processing upstream. Are you looking at a fastq file straight from the sequencing facility?

    Dario

    Leave a comment:


  • turnersd
    started a topic FASTQC problem on read with no sequence data

    FASTQC problem on read with no sequence data

    I've had a problem with FASTQC. I get the following error:

    Code:
    Failed to process file 0618107SM.fastq
    uk.ac.bbsrc.babraham.FastQC.Sequence.SequenceFormatException: Midline 'CAAACATACAGCTTAAAAC
    AACAGACATTTATTATCTTATGGT' didn't start with '+'
    When I look at the context around CAACATACA..... I see that there is a sequence identifier but no sequence info following it.

    Code:
    @HWUSI-EAS1758R:33:64PA7AAXX:4:1:6103:1039 1:N:0:
    CTCGATCCACAAACCGCCCTTGGGGTAAACATTCGG
    +
    IIIIIIIIIIIIIIIIHIIIIIIIIEHIGHHHHIII
    @:701;5677@<5@######################
    @HWUSI-EAS1758R:33:64PA7AAXX:4:1:6397:1046 1:N:0:
    CCTTAGGTTATTTCATGCCTAGAAATGTATCCTACA
    +
    HHGHHHGHHDHHHHHH@HHHHHHHHHHGHHHHGHHG
    @HWUSI-EAS1758R:33:64PA7AAXX:4:1:6580:1044 1:N:0:
    GATCGGAAGAGCTCGTATGCCGTCTTCTGCTTGAAA
    +
    GGGGEGDDGBHGHHHEGDGEGGD@GBB???GBGDBF
    It looks like the identifier that starts as "@:701;5677…" causes a failure at the next read. How would I get rid of these "empty" reads?

Latest Articles

Collapse

  • seqadmin
    Best Practices for Single-Cell Sequencing Analysis
    by seqadmin



    While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
    06-06-2024, 07:15 AM
  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    05-24-2024, 01:16 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, 06-14-2024, 07:24 AM
0 responses
12 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-13-2024, 08:58 AM
0 responses
14 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-12-2024, 02:20 PM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 06-07-2024, 06:58 AM
0 responses
186 views
0 likes
Last Post seqadmin  
Working...
X