150 bps Read Length Issue

[Arupsss]

I am doing some experiment with BowTie. Now, I want to do experiment with 150 bps read length. So, I download it from here. And converted to fastq format. Now, I see, the fastq format looks like,

@ERR103405.1 M10_151:1:2:12250:1321 length=302 ATTTACTGCCTTGTGTCTCCAGTGCGCTGAAAATACCTTTATCTTGAAATAAGTTAACTAACTCTTGGATACCTTTAATTAATGCTGGGTTACCACCAGAAATTGTAACGTGGTTAAATAAATCGCCACCAATACGTTTTAATTCATCATAGAACAGCTGGATGTGATTATCGCTGTAGCTGGTGTGATTCTGCATTTACTTGGGATGGTAGTGCTAAAGGCGATATAAAACTCATGACCGCTGAAGAAATTTATGATGAATTAAAACGTATTGGTGGCGATTTATTTAACCACGTTACAAT
+ERR103405.1 M10_151:1:2:12250:1321 length=302 CCCFFFFFHHHHHHHIHJJJJJIIJJIJJIJJJIIGJJJJIIGIJJHIGIIJJIIIJIIJJIJEIJIJFIIIFJGHHGHHFFFFFFFEDCCACCDA?ABDDDDDDCDC@?<ABBBDDDDEDDDC<?B?@BDDDDDB>CC@C:>AADDCACDB@CFFFDDHHBFHEHIIIIIGJIHHEGHIIHE1C?D?GGGIIIIGIFI>BHHIJ@3CHBDGGICHGEHIIGHE>BEDEDE;ACCDDCCA?B=BBCDCCCC@@>>C@CDC>@DCDCDDD<<@?AC(2??BDBDBCDCDDCC::?881<?C>:

Now in NCBI, they described it as "DNA for paried end (150bp) sequencing on an illumina MiSeq". But here it looks it is 302 bps read. Can anybody help me why it is given in above sequence, "length=302" while it is written in the page that it is a 150 bps read.

[NextGenSeq]

It's a paired end 151 cycle read

[Arupsss]

It's a paired end 151 cycle read

Thanks. But, I want to give input 150 bps length read to Bowtie Tool. So, what I should do ? I search for 150 bp and get those as result.

[HESmith]

For technical reasons, the error rates are higher for the last base. Those can be removed with a variety of tools (e.g., Trimmomatic). I suggest you search the wiki.

[Arupsss]

For technical reasons, the error rates are higher for the last base. Those can be removed with a variety of tools (e.g., Trimmomatic). I suggest you search the wiki.

Thanks. But, it is not possible to get 150 bps read length .sar file and fed it into Bowtie ? Another point is: here (http://www.ncbi.nlm.nih.gov/sra/SRX145461) it says 1 forward, 151 reverse. Can you inform does it mean ?

[HESmith]

Obtaining 150bp of high-quality sequence data requires 151 cycle sequencing (followed by trimming of the final low-quality base). Paired-end sequencing doubles the number of cycles: 2x151=302. SRA contains the raw (i.e., untrimmed) data.

[Arupsss]

Obtaining 150bp of high-quality sequence data requires 151 cycle sequencing (followed by trimming of the final low-quality base). Paired-end sequencing doubles the number of cycles: 2x151=302. SRA contains the raw (i.e., untrimmed) data.

Is paired end read (or 1 forward, 151 reverse) means first end is taken from DNA's forward stand and second one taken from DNA's reverse strand ? Means are they reverse complement ? Sorry, I have very little idea about Bioinformatics. Another point is,

"Obtaining 150bp of high-quality sequence data requires 151 cycle sequencing (followed by trimming of the final low-quality base)" - is this means last base of 151 bps should be dropped by the tool ?

[HESmith]

The answers to your questions can be found by searching the forum.