I am running Eland to map short sequence reads to genome, but the script fails on the first line of the fastq file with the following message:
The first four lines of the fastq file look like this:
Is there something wrong with the fastq format or am I missing something? 
Thanks
Could not identify index of the following line: SRR001460.1 USI-EAS21_0017_4021:8:1:243:905 length=24
Please check your files.
Please check your files.
Code:
@SRR001460.1 USI-EAS21_0017_4021:8:1:243:905 length=24 AAGGGAATGTTCAACTCTTTGACT +SRR001460.1 USI-EAS21_0017_4021:8:1:243:905 length=24 IIIIIIIIIIIIIIIIIIIIIIII

Thanks
Comment