Eland error: Could not identify index

[CATCH]

I am running Eland to map short sequence reads to genome, but the script fails on the first line of the fastq file with the following message:

Could not identify index of the following line: SRR001460.1 USI-EAS21_0017_4021:8:1:243:905 length=24
Please check your files.

The first four lines of the fastq file look like this:

@SRR001460.1 USI-EAS21_0017_4021:8:1:243:905 length=24
AAGGGAATGTTCAACTCTTTGACT
+SRR001460.1 USI-EAS21_0017_4021:8:1:243:905 length=24
IIIIIIIIIIIIIIIIIIIIIIII

Is there something wrong with the fastq format or am I missing something?

Thanks

[SillyPoint]

I think the canonical format for the read name in the first line of a fastq read is:

@<run_id>:<lane>:<tile>:<x>:<y>#<index_tag>/<read_number>

The index tag and read ID are optional.

I'm pretty sure your problem is due to the spaces in your run id. I'd be a bit suspicious of the length=24 bit as well.

--TS

[CATCH]

I tried making a test file deleting different parts of the id line, but all the formats below give the same error:

@SRR001460.1_USI-EAS21_0017_4021:8:1:243:905_length=24
AAGGGAATGTTCAACTCTTTGACT
+SRR001460.1_USI-EAS21_0017_4021:8:1:243:905_length=24
IIIIIIIIIIIIIIIIIIIIIIII

@SRR001460.1 USI-EAS21_0017_4021:8:1:243:905
AAGGGAATGTTCAACTCTTTGACT
+SRR001460.1 USI-EAS21_0017_4021:8:1:243:905
IIIIIIIIIIIIIIIIIIIIIIII

@USI-EAS21_0017_4021:8:1:243:905 length=24
AAGGGAATGTTCAACTCTTTGACT
+USI-EAS21_0017_4021:8:1:243:905 length=24
IIIIIIIIIIIIIIIIIIIIIIII

@USI-EAS21_0017_4021:8:1:243:905
AAGGGAATGTTCAACTCTTTGACT
+USI-EAS21_0017_4021:8:1:243:905
IIIIIIIIIIIIIIIIIIIIIIII

So it does not help to delete neither the spaces, nor the first part or the last part. I would have thought that the last one of these three versions would work.

Are any special characters disallowed in the name?

[SillyPoint]

Hmmm...

Reading the error message more carefully, it says "Could not identify index".

Recall that the read name format is:

@<run_id>:<lane>:<tile>:<x>:<y>#<index_tag>/<read_number>

I just had a read of ELAND_standalone.pl, the module which issues the message. It expects an index tag to be present. I.e., the index is *not* optional with ELAND_standalone.pl. That is also true of the read_number.

Also, the run_id must contain only a-z, A-Z, 0-9 and underscore. So no dash or dot. The lane, tile, x & y fields must be numeric.

So try something like @SRR001460_1_USI_EAS21_0017_4021:8:1:243:905#1/1

Good luck.

--TS