[JQL]

The one sequence that escaped has a slightly different sequence than the standard adapter sequence and was thus probably missed out. Not sure why this is, but you could either run it again using the end of that very sequence in question or just don't bother because a full length adapter sequence is not going to align anyway.

The ratio of the last 3 bases changes due to the trimming, so if you remove e.g. the A from the read then the A content will go down while other bases contents go up. The bias in the start looks very much like the bias from random hexamer priming which is quite typical and has been discussed in several threads already. Overall I think you should be good to start aligning your reads now!

Thanks Felix. Great, I am ready for my very first RNA-seq then!

[magisterh]

Please help! (Trim Galore of RRBS data)

Hi!

I want to use Trim Galore to precess RRBS data before working with bismark.
System win7 ultimate, 64bit
However, I get the following error message:

Traceback (most recent call last):
File "F:\RRBSCML\cutadapt\scripts\cutadapt.py", line 71, in <module> from cutadapt import seqio, __version__
ImportError: cannot import name seqio

What am I doing wrong?

Thanks for help!!

[fkrueger]

Hi magisterh,

The error you are seeing is caused by Cutadapt not being able to find required packages under Windows. I would suggest to either contact Marcel Martin directly (the developer of Cutadapt), or follow BB's suggestion to use his suite of tools.

[Nikhil]

trim galore and cutadapt software errors

hi...

this is the error i am getting while running the Trim galore and cutadapt... what is the exactly this error, and how can solve this problem ????

cutadapt/_align.c:8:22: fatal error: pyconfig.h: No such file or directory

#include "pyconfig.h"

^

compilation terminated.

error: command 'x86_64-linux-gnu-gcc' failed with exit status 1

----------------------------------------
Cleaning up...
Command /usr/bin/python -c "import setuptools, tokenize;__file__='/tmp/pip_build_manman/cutadapt/setup.py';exec(compile(getattr(tokenize, 'open', open)(__file__).read().replace('\r\n', '\n'), __file__, 'exec'))" install --record /tmp/pip-V_zM1D-record/install-record.txt --single-version-externally-managed --compile failed with error code 1 in /tmp/pip_build_manman/cutadapt
Storing debug log for failure in /home/manman/.pip/pip.log

[Nikhil]

Hi
I try to run trim galore but received an error message (pasted below). It says "cutadapt ... failed at /usr/local/bin/trim_galore line 420". Anyone knows what it means?

thanks


###############################
$ No quality encoding type selected. Assuming that the data provided uses Sanger encoded Phred scores (default)


SUMMARISING RUN PARAMETERS
==========================
Input filename: Sample_C1.R1.fastq.gz
Quality Phred score cutoff: 20
Quality encoding type selected: ASCII+33
Adapter sequence: 'GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG'
Maximum trimming error rate: 0.1 (default)
Minimum required adapter overlap (stringency): 20 bp
Minimum required sequence length before a sequence gets removed: 20 bp
Running FastQC on the data once trimming has completed
Running FastQC with the following extra arguments: '--outdir ./'
Output file will be GZIP compressed

Writing final adapter and quality trimmed output to Sample_C1.R1_trimmed.fq


>>> Now performing quality (cutoff 20) and adapter trimming in a single pass for the adapter sequence: 'GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG' from file Sample_C1.R1.fastq.gz <<<
open3: exec of cutadapt -f fastq -e 0.1 -q 20 -O 20 -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG Sample_C1.R1.fastq.gz failed at /usr/local/bin/trim_galore line 420

RUN STATISTICS FOR INPUT FILE: Sample_C1.R1.fastq.gz
=============================================
0 sequences processed in total
Illegal division by zero at /usr/local/bin/trim_galore line 506.
^C
[3]- Exit 255 trim_galore --fastqc_args "--outdir ./" -a GATCGGAAGAGCACACGTCTGAACTCCAGTCACTTAGGCATCTCGTATGCCGTCTTCTGCTTG -s 20 Sample_C1.R1.fastq.gz

hi ....
i am also getting the same error ... please can tell me how did you try to solve this problem ????

[dpryan]

Please don't cross-post on here and Biostars (where I already replied).

[fkrueger]

Thanks Ryan for your help. To edit the path to Cutadapt, open Trim Galore in a text editor and edit the path to the Cutadapt executable where it says:

# change these paths if needed:
my $path_to_cutadapt = 'cutadapt';
...

[varenkardz]

Hi everyone, does anyone know how to fix this trim galore/cutadapt error:


SUMMARISING RUN PARAMETERS
==========================
Input filename: paired
Trimming mode: single-end
Trim Galore version: 0.3.7
Quality Phred score cutoff: 20
Quality encoding type selected: ASCII+33
Adapter sequence: 'AGATCGGAAGAGC'
Maximum trimming error rate: 0.1 (default)
Minimum required adapter overlap (stringency): 1 bp
Minimum required sequence length before a sequence gets removed: 20 bp

Writing final adapter and quality trimmed output to paired_trimmed.fq


>>> Now performing quality (cutoff 20) and adapter trimming in a single pass for the adapter sequence: 'AGATCGGAAGAGC' from file paired <<<
'import site' failed; use -v for traceback
Traceback (most recent call last):
File "/jhpce/shared/community/compiler/gcc/4.4.7/python/3.4.0/lib/python3.4/encodings/__init__.py", line 31, in <module>
import codecs
File "/jhpce/shared/community/compiler/gcc/4.4.7/python/3.4.0/lib/python3.4/codecs.py", line 88
*, _is_text_encoding=None):
^
SyntaxError: invalid syntax


Cutadapt terminated with exit signal: '256'.
Terminating Trim Galore run, please check error message(s) to get an idea what went wrong...



Yet codecs is part of my available python modules!

[fkrueger]

Hi Varenka,

not quite sure what is going wrong exactly but you need to get Cutadapt up and running before using Trim Galore. If you enter

$ cutadapt

you should see the Cutadapt help, does that work? If you run FastQC on your input file ('paired'), does that run to completion? This should tell you if something is wrong with the input file. Other than that... hmm, try reinstalling Cutadapt following their exact installation guidelines?