how to tell fastq format before and after pipeline 1.3

[yuanlang]

Hi,

By checking previous posts in the forum, I understand now there is difference in quality score scaling before and after GApipeline 1.3. Thanks very much to authors of those posts and the author of the wikipedia page of fastq.

I got some fastq data from others recently. But they did not tell me whether these data were generated by 1.3+ or previous pipelines. How can I tell just from the content of data file whether these fastq data are from GApipeline 1.3+ or not?

The data looks like as follows:

@7_xQRfTHiJ321/1
CTCTGAAGCTGCGTTTACTTATGTTGATATCTACTCTATCAAGCTTACTCTCATCACTCAAGCCAAGAAACTCGG
+
a`aaaZ^`^aaaa_aa`aaaa``^_a]`aa`a_`aa`\`a`Y`^_a`_a_aaa`a``_``_aZ]\Xa_[__][\[
@5_SPRfTHiJ321/1
TTTGGCTTTGTGTCTTTTAACAAGGAAACACTAATTAGGCTTATAAGATGCGGTTGCGGTTTAAGTCCTTATACT
+
aababaabaa_aa\aaaa^aa`aaa``a\_[a^]aa`aa_aa_aY^__`aXaa]``S`aV[YJVYOOTY_U\OJV

Thank you very much!

[maubp]

If you have some *poor* quality reads, you can tell from the data itself.

ASCII 59 (Solexa -5) to 63 (Solexa -1) are only possible in the old Solexa/Illumina pipeline FASTQ files.

If all the ASCII values are 64 or higher, you can't be sure, and getting it wrong will make a slight difference (unless you are doing some strict quality trimming/filtering anyway).

If all the ASCII values are 74 or higher, either way the Solexa/PHRED scores are at least 10 and are effectively equal, so it doesn't matter.

But try and ask your sequencing supplier to make sure.