Seqanswers Leaderboard Ad



No announcement yet.
  • Filter
  • Time
  • Show
Clear All
new posts

  • Samtools: Paired reads with no Ref. name of the mate

    In some bam files from paired reads data I see some of them with the field RNEXT or reference of the mate equal to "*". In these cases which flags should or not be used? Some examples of these reads are:

    WESLEY:8:80:156:228/1/2        129     chr1    566704  255     69M     *       0       0       CCCTAATAATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCCC   SWTTZ^WWYQYLQTQU^RRWZ`_ZROQ_^YYW^_aa_aa_`a^aaabaaababaaba`^``baa_bbbb
    SOCAC:1:25:373:836/2/1  65      chr1    566430  255   4S54M18S        *       0       0       CTGTAGCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTAATCCCTACAGATCGGAAGAGCGTCGCG    abbabbbbbaaabbbababbaaabbaaZH[^]ab\aa]^aa\S_aaa\`Za`]_a`a^Ua_]LYL\MVXaYU^BBB
    SOCAC:2:75:1643:1924/2/2        145     chr1    566428  255     63M6S   *       0       0       TCAGCCATTTTACCTCACCCCCACTGNTGTTCGCCGACCGTTGACTATTCTCCACAAACCACAGATCGG   a`bbaabababb`^baba`Wa`a[`^D\baa`\L\a_aZa_[``_`]a```]KYY]``WBBBBBBBBBB

Latest Articles


  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin

    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM
  • seqadmin
    Strategies for Sequencing Challenging Samples
    by seqadmin

    Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
    03-22-2024, 06:39 AM





Topics Statistics Last Post
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
Last Post seqadmin  
Started by seqadmin, 04-04-2024, 09:00 AM
0 responses
Last Post seqadmin  