Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Samtools: Paired reads with no Ref. name of the mate

    Hi,
    In some bam files from paired reads data I see some of them with the field RNEXT or reference of the mate equal to "*". In these cases which flags should or not be used? Some examples of these reads are:

    Code:
    WESLEY:8:80:156:228/1/2        129     chr1    566704  255     69M     *       0       0       CCCTAATAATCGGTGCCCCCGATATGGCGTTTCCCCGCATAAACAACATAAGCTTCTGACTCTTACCCC   SWTTZ^WWYQYLQTQU^RRWZ`_ZROQ_^YYW^_aa_aa_`a^aaabaaababaaba`^``baa_bbbb
    SOCAC:1:25:373:836/2/1  65      chr1    566430  255   4S54M18S        *       0       0       CTGTAGCCATTTTACCTCACCCCCACTGATGTTCGCCGACCGTTGACTAATCCCTACAGATCGGAAGAGCGTCGCG    abbabbbbbaaabbbababbaaabbaaZH[^]ab\aa]^aa\S_aaa\`Za`]_a`a^Ua_]LYL\MVXaYU^BBB
    SOCAC:2:75:1643:1924/2/2        145     chr1    566428  255     63M6S   *       0       0       TCAGCCATTTTACCTCACCCCCACTGNTGTTCGCCGACCGTTGACTATTCTCCACAAACCACAGATCGG   a`bbaabababb`^baba`Wa`a[`^D\baa`\L\a_aZa_[``_`]a```]KYY]``WBBBBBBBBBB
    Thanks

Latest Articles

Collapse

  • seqadmin
    Essential Discoveries and Tools in Epitranscriptomics
    by seqadmin




    The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
    04-22-2024, 07:01 AM
  • seqadmin
    Current Approaches to Protein Sequencing
    by seqadmin


    Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
    04-04-2024, 04:25 PM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 08:47 AM
0 responses
9 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-11-2024, 12:08 PM
0 responses
60 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 10:19 PM
0 responses
57 views
0 likes
Last Post seqadmin  
Started by seqadmin, 04-10-2024, 09:21 AM
0 responses
53 views
0 likes
Last Post seqadmin  
Working...
X