Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • syfo
    Just a member
    • Nov 2012
    • 103

    Inconsistent pairing in SAM file?

    In that SAM file, read1's mate is read2 but read2's mate is not read1. Is that possible? Both are on chrX, convergent orientation (-> <-), perfectly mapped (36M).

    Code:
    HWI-M00185:3:000000000-A1BH4:1:1101:5903:5381   353     chrX    66951034        254     36M     =       66957305        0       AAATGGCAAAAAGACAAAAATAAATAAATAAATAAA    ?????BBBDDDBDDDDFFFFFFIIIIIIIIIHIIII    RG:Z:0  NM:i:0  XT:A:R  md:Z:36
    HWI-M00185:3:000000000-A1BH4:1:1101:5903:5381   145     chrX    66957305        254     36M     chr18   37526012        0       ACATGGTAACCTGTCTCATAGCAGGACTCTGGAATG    ?????BBBDDDDDDDDFFFFFFCHIHHIIIIIFHII    RG:Z:0  NM:i:1  XT:A:U  md:Z:1T34
    Am I missing something or something is wrong here? How can read2's mate be on chr18 while it could be read1?

    Reads from the two fastq files:
    Code:
    @HWI-M00185:3:000000000-A1BH4:1:1101:5903:5381 1:N:0:GTCCGCTTTATTTATTTATTTATTTTTGTCTTTTTGCCATTT
    @HWI-M00185:3:000000000-A1BH4:1:1101:5903:5381 2:N:0:GTCCGCCATTCCAGAGTCCTGCTATGAGACAGGTTACCATGT
    I used the GEM mapper
    What do you think, bug or feature?
    Thanks
  • kmcarr
    Senior Member
    • May 2008
    • 1181

    #2
    Originally posted by syfo View Post
    In that SAM file, read1's mate is read2 but read2's mate is not read1. Is that possible? Both are on chrX, convergent orientation (-> <-), perfectly mapped (36M).

    Code:
    HWI-M00185:3:000000000-A1BH4:1:1101:5903:5381   353     chrX    66951034        254     36M     =       66957305        0       AAATGGCAAAAAGACAAAAATAAATAAATAAATAAA    ?????BBBDDDBDDDDFFFFFFIIIIIIIIIHIIII    RG:Z:0  NM:i:0  XT:A:R  md:Z:36
    HWI-M00185:3:000000000-A1BH4:1:1101:5903:5381   145     chrX    66957305        254     36M     chr18   37526012        0       ACATGGTAACCTGTCTCATAGCAGGACTCTGGAATG    ?????BBBDDDDDDDDFFFFFFCHIHHIIIIIFHII    RG:Z:0  NM:i:1  XT:A:U  md:Z:1T34
    Am I missing something or something is wrong here? How can read2's mate be on chr18 while it could be read1?

    Reads from the two fastq files:
    Code:
    @HWI-M00185:3:000000000-A1BH4:1:1101:5903:5381 1:N:0:GTCCGCTTTATTTATTTATTTATTTTTGTCTTTTTGCCATTT
    @HWI-M00185:3:000000000-A1BH4:1:1101:5903:5381 2:N:0:GTCCGCCATTCCAGAGTCCTGCTATGAGACAGGTTACCATGT
    I used the GEM mapper
    What do you think, bug or feature?
    Thanks
    Read 1 has multiple alignments. The FLAG value for the read 1 alignment, 353, indicates that this reported alignment is not "primary" meaning there is at least one other alignment for read 1. The primary alignment for read 1 is at chr18:37526012.

    How primary/secondary alignments are determined and reported is a function of the mapping program used. I am not familiar with GEM mapper so can't provide any insight there.

    Comment

    • syfo
      Just a member
      • Nov 2012
      • 103

      #3
      Right, I forgot to precise that GEM is exhaustive and reports *all* possible alignments within a maximum number of mismatches. There are indeed many other alignments for read1.
      Still, I find it surprising that the primary alignment is transchromosomal (chrX-chr18) when a perfect match is found for a mate on the same chromosome. I should probably ask the authors.
      Thanks for your answer kmcarr.

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM
      • SEQadmin2
        Cancer Drug Resistance: The Lingering Barrier to Rising Survival
        by SEQadmin2



        Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

        There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
        07-08-2026, 05:17 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, 07-24-2026, 12:17 PM
      0 responses
      25 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-23-2026, 11:41 AM
      0 responses
      19 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-20-2026, 11:10 AM
      0 responses
      26 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-13-2026, 10:26 AM
      0 responses
      38 views
      0 reactions
      Last Post SEQadmin2  
      Working...