Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • upper
    replied
    Originally posted by swbarnes2 View Post
    Set the VALIDATION_STRINGENCY to LENIENT. Picard will still warn you about those reads, but it will go past them.

    bwa will throw the 4 flag if a read hangs off the edge of one of your references, but it will also give it a mapping position and MAPQ. That likely is the source of your problem reads.
    thank you,picard ignore these reads and continue process,and also picard just report error as before but didnot remove these reads,this is what I want.

    Code:
    INPUT=s_3_2/s_3_2_unmap_genome.sam FASTQ=s_3_2/s_3_2_unmap_genome.fq VALIDATION_STRINGENCY=LENIENT
    
    Ignoring SAM validation error due to lenient parsing:
    Error parsing text SAM file. MAPQ should be 0 for unmapped read.; Line 3205583
    Line: HWUSI-EAS724_0039:3:34:15714:3092#0       20      9       124595110       37      80M     *       0       0       AGTTAATGTAGCTTAATAACAAAGCAAAGCACTGAAA
    ATGCTTAGATGGATAATTGTATCCCATAAACACAAAGGTTTGG        hggh]hghhhghghhhhhghhhhhhhhhhhdhhhhhhhcfhhghhhhhhhchhhghhfdhhhghhhhhhgghhghhghhh        XT:A:U  NM:i:1  XN
    :i:1  X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:0G79

    Leave a comment:


  • swbarnes2
    replied
    Set the VALIDATION_STRINGENCY to LENIENT. Picard will still warn you about those reads, but it will go past them.

    bwa will throw the 4 flag if a read hangs off the edge of one of your references, but it will also give it a mapping position and MAPQ. That likely is the source of your problem reads.

    Leave a comment:


  • picard SamToFastq error in umapped reads which MAPQ is not 0

    Hi,
    SamToFastq.jar will be stop when it meet the unmapped reads which flag is 4 or 20 but the MAPQ is not 0. Picard is not so smart,it couldnot skip this reads but stop to deal next reads.
    I am also confused why unmapped reads MAPQ is not 0? I found many of unmapped reads which flag is 4 or 20 has MAPQ and OPT column. MAPQ 37 is the highest sore in bwa reasult and normal means its unique mapping reads.
    I use bwa Version: 0.6.1-r104 to do mapping.
    Can someone know how to deal these reads,I want to mapping unmaped reads to junction?


    Code:
    java -jar SamToFastq.jar INPUT=s_3_2_unmap_genome.sam FASTQ=s_3_2_unmap_genome.fq
    
    
    Wed Dec 05 09:27:59 HKT 2012] net.sf.picard.sam.SamToFastq done. Elapsed time: 1.19 minutes.
    Runtime.totalMemory()=262864896
    FAQ:  http://sourceforge.net/apps/mediawiki/picard/index.php?title=Main_Page
    Exception in thread "main" net.sf.samtools.SAMFormatException: Error parsing text SAM file. MAPQ should be 0 for unmapped read.; Line 3205583
    Line: HWUSI-EAS724_0039:3:34:15714:3092#0       20      9       124595110       37      80M     *       0       0       AGTTAATGTAGCTTAATAACAAAGCAAAGCACTGAAA
    ATGCTTAGATGGATAATTGTATCCCATAAACACAAAGGTTTGG        hggh]hghhhghghhhhhghhhhhhhhhhhdhhhhhhhcfhhghhhhhhhchhhghhfdhhhghhhhhhgghhghhghhh        XT:A:U  NM:i:1  XN
    :i:1  X0:i:1  X1:i:0  XM:i:1  XO:i:0  XG:i:0  MD:Z:0G79
            at net.sf.samtools.SAMTextReader.reportErrorParsingLine(SAMTextReader.java:230)
            at net.sf.samtools.SAMTextReader.access$500(SAMTextReader.java:40)
            at net.sf.samtools.SAMTextReader$RecordIterator.parseLine(SAMTextReader.java:434)
            at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:278)
            at net.sf.samtools.SAMTextReader$RecordIterator.next(SAMTextReader.java:250)
            at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:641)
            at net.sf.samtools.SAMFileReader$AssertableIterator.next(SAMFileReader.java:619)
            at net.sf.picard.sam.SamToFastq.doWork(SamToFastq.java:129)
            at net.sf.picard.cmdline.CommandLineProgram.instanceMain(CommandLineProgram.java:177)
            at net.sf.picard.sam.SamToFastq.main(SamToFastq.java:118)
    Last edited by upper; 12-05-2012, 05:33 PM.

Latest Articles

Collapse

  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Today, 10:28 AM
0 responses
5 views
0 likes
Last Post seqadmin  
Started by seqadmin, Today, 07:35 AM
0 responses
8 views
0 likes
Last Post seqadmin  
Started by seqadmin, Yesterday, 02:06 PM
0 responses
8 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-14-2024, 07:03 AM
0 responses
28 views
0 likes
Last Post seqadmin  
Working...
X