Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • cscswimmer227
    Junior Member
    • Nov 2011
    • 4

    #1

    BWA Not Printing QNAME in SAM File

    I am trying to align simulated single-end reads using BWA. There alignment works well, however BWA does not print the QNAME of the read. I had to write a script to manually add a '*' to the QNAME field for samtools to correctly convert the BWA SAM file to BAM.

    Is the problem me using single-end reads? Or is there a way to have BWA print out the QNAME in the SAM file?

    Here is what my FASTQ file looks like:
    Code:
    @ Sequence.1
    GACGGCAACATTCTTCCGCGGATTGGTGCCACCACGACCTG
    + 
    I@HIIHIIIHHIB<IIFII7GAIHHB6I8I=CI;,:-280:
    @ Sequence.2
    CGTCGCGCCGCGTTGTCGTTGATTCGGCCCCGGCGAACATTAACAATGGCCGCTA
    + 
    [email protected]@B,4A98:47:,:
    @ Sequence.3
    AAAGCCTTTAATTAAGGCCTTTAAATGCCCCAAACTCGCGAGCCTCCCGGC
    + 
    IIHIIIFCIIIIIIIIFIIIHIICD?E@<II,>7DH8,I,/3E1/2:22-,
    And the corresponding SAM file:
    Code:
    @SQ     SN:Simulation   LN:100000
            0       Simulation      1590    37      41M     *       0       0       GACGGCAACATTCTTCCGCGGATTGGTGCCACCACGACCTG       I@HIIHIIIHHIB<IIFII7GAIHHB6I8I=CI;,:-280:       XT:A:U  NM:i:0  X0:i:1  X1:i:0  XM:i:0  XO:i:0  XG:i:0  MD:Z:41
            0       Simulation      76014   37      55M     *       0       0       CGTCGCGCCGCGTTGTCGTTGATTCGGCCCCGGCGAACATTAACAATGGCCGCTA [email protected]@B,4A98:47:,: XT:A:U  NM:i:0  X0:i:1  X1:i:0  XM:i:0  XO:i:0  XG:i:0  MD:Z:55
            0       Simulation      60875   37      51M     *       0       0       AAAGCCTTTAATTAAGGCCTTTAAATGCCCCAAACTCGCGAGCCTCCCGGC     IIHIIIFCIIIIIIIIFIIIHIICD?E@<II,>7DH8,I,/3E1/2:22-,     XT:A:U  NM:i:0  X0:i:1  X1:i:0  XM:i:0  XO:i:0  XG:i:0  MD:Z:51
    Thanks for any help!

    ---------------------------------------------------------------------------------------------------------------------------

    The solution as GenoMax pointed out is that there is a whitespace between the '@' and the first character.
    Last edited by cscswimmer227; 12-12-2012, 09:09 AM. Reason: Solution solved
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    Is there a whitespace between the "@" and the ID of the sequence in your file?

    Comment

    • cscswimmer227
      Junior Member
      • Nov 2011
      • 4

      #3
      That was the problem. Thank you!

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
        by SEQadmin2



        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

        Despite this, “CRISPR helped turn genome editing from a specialized technique into
        ...
        Today, 11:01 AM
      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM
      • SEQadmin2
        Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
        by SEQadmin2



        Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
        ...
        07-09-2026, 11:10 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, Today, 02:55 AM
      0 responses
      7 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-24-2026, 12:17 PM
      0 responses
      12 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-23-2026, 11:41 AM
      0 responses
      12 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-20-2026, 11:10 AM
      0 responses
      24 views
      0 reactions
      Last Post SEQadmin2  
      Working...