BWA Not Printing QNAME in SAM File

[cscswimmer227]

I am trying to align simulated single-end reads using BWA. There alignment works well, however BWA does not print the QNAME of the read. I had to write a script to manually add a '*' to the QNAME field for samtools to correctly convert the BWA SAM file to BAM.

Is the problem me using single-end reads? Or is there a way to have BWA print out the QNAME in the SAM file?

Here is what my FASTQ file looks like:

@ Sequence.1
GACGGCAACATTCTTCCGCGGATTGGTGCCACCACGACCTG
+ 
I@HIIHIIIHHIB<IIFII7GAIHHB6I8I=CI;,:-280:
@ Sequence.2
CGTCGCGCCGCGTTGTCGTTGATTCGGCCCCGGCGAACATTAACAATGGCCGCTA
+ 
[email protected]@B,4A98:47:,:
@ Sequence.3
AAAGCCTTTAATTAAGGCCTTTAAATGCCCCAAACTCGCGAGCCTCCCGGC
+ 
IIHIIIFCIIIIIIIIFIIIHIICD?E@<II,>7DH8,I,/3E1/2:22-,

And the corresponding SAM file:

@SQ     SN:Simulation   LN:100000
        0       Simulation      1590    37      41M     *       0       0       GACGGCAACATTCTTCCGCGGATTGGTGCCACCACGACCTG       I@HIIHIIIHHIB<IIFII7GAIHHB6I8I=CI;,:-280:       XT:A:U  NM:i:0  X0:i:1  X1:i:0  XM:i:0  XO:i:0  XG:i:0  MD:Z:41
        0       Simulation      76014   37      55M     *       0       0       CGTCGCGCCGCGTTGTCGTTGATTCGGCCCCGGCGAACATTAACAATGGCCGCTA [email protected]@B,4A98:47:,: XT:A:U  NM:i:0  X0:i:1  X1:i:0  XM:i:0  XO:i:0  XG:i:0  MD:Z:55
        0       Simulation      60875   37      51M     *       0       0       AAAGCCTTTAATTAAGGCCTTTAAATGCCCCAAACTCGCGAGCCTCCCGGC     IIHIIIFCIIIIIIIIFIIIHIICD?E@<II,>7DH8,I,/3E1/2:22-,     XT:A:U  NM:i:0  X0:i:1  X1:i:0  XM:i:0  XO:i:0  XG:i:0  MD:Z:51

Thanks for any help!

---------------------------------------------------------------------------------------------------------------------------

The solution as GenoMax pointed out is that there is a whitespace between the '@' and the first character.

[GenoMax]

Is there a whitespace between the "@" and the ID of the sequence in your file?

[cscswimmer227]

That was the problem. Thank you!