Header Leaderboard Ad

Collapse

understanding pindel output

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • understanding pindel output

    Hi everybody,

    I really tried to understand the different files I get when running pindel with the following command:
    Code:
    pindel -f Mus_musculus.NCBIM37.66.dna.fa -i bwa_trimmedData.txt -c ALL -o rimmedData_default
    Well, I get a list of 7 different files - BP, INV, D, LI, SI, TD and CloseEndMapped, some of them are empty, some are not.
    When I tried to understand the results I compared my output to the one on the pindel web site. Unfortunately it was not possible.

    Here is an example of LI
    Code:
    ########################################################
    0	LI	ChrID MT1	790	+ 4	791	- 4	A_bwa_trimmed75_default + 3 - 3	G_default + 1 - 1
    GTATTAAAGTAAGCAAAAGAATCAAACATAAAAACGTTAGGTCAAGGTGTAGCCAATGAAATGGGAAGAAATGGGCTACAttttcttataaaagaacattactataccctttatgaaactaaaggactaaggaggatttagtagtaaattaagaatagag
                                                                          ATTGGCTACACCTTGACCTAACGTTTTTATGTTTGATTCTTTTGCTTACTTTAATACCTTTTTAGGGGTTGCTGAAGATG	+	22	60	A_default	@HWI-ST863:138:D0WT7ACXX:5:1210:19323:84582/2
                                                                          ATTGGCTACACCTTGACCTAACGTTTTTATGTTTGATTCTTTTGCTTACTTTAATACCTTTTTAGGGGTTGCTGAAGATG	+	106	60	A_default	@HWI-ST863:138:D0WT7ACXX:5:1308:13343:59960/2
                                                                          ATTGGCTACACCTTGACCTAACGTTTTTATGTTTGATTCTTTTGCTTACTTTAATATCTTTTTAGGGTTTGCTGAAGATG	+	145	60	A_default	@HWI-ST863:138:D0WT7ACXX:5:2108:5597:62957/1
                                                                          ATTGGCTACACCTTGACCTAACGTTTTTATGTTTGATTCTTTTGCTTACTNTAATACCTTTTTAGGGTTTGCTGAAGATG	+	69	60	G_default	@HWI-ST863:138:D0WT7ACXX:5:2209:8563:77307/2
    --------------------------------------------------------
    gtattaaagtaagcaaaagaatcaaacataaaaacgttaggtcaaggtgtagccaatgaaatgggaagaaatgggctacaTTTTCTTATAAAAGAACATTACTATACCCTTTATGAAACTAAAGGACTAAGGAGGATTTAGTAGTAAATTAAGAATAGAG
              CTAGATGGATATAAAGTACCGCCAAGTCCTTTGAGTTTTAAGCTATGGCTAGTAGTTCTCTGGCAAATAGTTTTGTTATA	-	1219	60	A_default	@HWI-ST863:138:D0WT7ACXX:5:2316:6189:1992/2
                                               CAAGGGGGAGCCAATGAAAGGAGAAGGATTATGCTAGATTTTCTTATAAAAGGACATTACTATACCATTTATGAAACTAA	-	1573	29	A_bwa_trimmed75_default	@HWI-ST863:138:D0WT7ACXX:5:2316:16450:36161/2
             TATATTGTTTATTACCATGTATATCTTTTCTTTTTTTTGTTATAATCTAATCTTTTTTTTTTTTTTTTTTTTTTTTTTAT	-	2175	29	A_default	@HWI-ST863:138:D0WT7ACXX:5:1206:12241:67098/2
              TTTTTTTTTTTTTTGTTTTTATTTCTAAAAAATAATTTTTCATATAAATTTTGTTTTTTATTTTTTTTTTTTTTTTTATA	-	1171	29	G_default	@[COLOR="Red"]HWI-ST863:138:D0WT7ACXX:5:2304:2584:12569[/COLOR]/2
    ########################################################
    I would like to know how to understand this list.
    somehow the results from pindel doesn't match the bam file.
    here is the sequence from the bam file for the last read from above:
    Code:
     samtools view G.bam | grep "HWI-ST863:138:D0WT7ACXX:5:2304:2584:12569"
    [COLOR="Red"]HWI-ST863:138:D0WT7ACXX:5:2304:2584:12569[/COLOR]       89      MT      582     50      90M     *       0       0       CTCAAAGGACTTGGCGGTACTTTATATCCATCTAGAGGAGCCTGTTCTATAATCGATAAACCCCGCTCTACCTCACCATCTCTTGCTAAT      BCDCCDDDCBBB>[email protected]?JJJJJJJJHGJJIHFJIHFHHHFFFFFCCB      AS:i:0       XN:i:0  XM:i:0  XO:i:0  XG:i:0  NM:i:0  MD:Z:90 YT:Z:UU NH:i:1
    the mapping qualities differ in both results, the positions are not the same. I find it quite difficult to interpret the results to an understandable read list.
    Another fact I don't understand is the difference in the sequence. What do the letters in upper case stand for? what is the different between them to the lower case?
    Where can I see the beginning of my insertion?

    Is there a better manual to this software?
    Is there a way to visualize the results, so that I can see the reads as an alignment?

    Thanks
    Assa
    Last edited by frymor; 01-21-2013, 06:59 AM. Reason: some more questions

  • #2
    Indeed the Pindel documentation needs more work. Sorry for the inconvenience. Jirapong helped me on the text and I still need to update the wiki site. I will update the wiki site this week and give you a signal when I finish.

    Kai

    Comment

    Latest Articles

    Collapse

    • seqadmin
      A Brief Overview and Common Challenges in Single-cell Sequencing Analysis
      by seqadmin


      ​​​​​​The introduction of single-cell sequencing has advanced the ability to study cell-to-cell heterogeneity. Its use has improved our understanding of somatic mutations1, cell lineages2, cellular diversity and regulation3, and development in multicellular organisms4. Single-cell sequencing encompasses hundreds of techniques with different approaches to studying the genomes, transcriptomes, epigenomes, and other omics of individual cells. The analysis of single-cell sequencing data i...

      01-24-2023, 01:19 PM
    • seqadmin
      Introduction to Single-Cell Sequencing
      by seqadmin
      Single-cell sequencing is a technique used to investigate the genome, transcriptome, epigenome, and other omics of individual cells using high-throughput sequencing. This technology has provided many scientific breakthroughs and continues to be applied across many fields, including microbiology, oncology, immunology, neurobiology, precision medicine, and stem cell research.

      The advancement of single-cell sequencing began in 2009 when Tang et al. investigated the single-cell transcriptomes
      ...
      01-09-2023, 03:10 PM

    ad_right_rmr

    Collapse
    Working...
    X