Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • contig overlaps in velvet 1.2.03

    Hi, I did a denovo assembly using velvet 1.2.03 which gave me 1626 contigs,

    However, when I examined the contig.fa output by velvet, eg
    >NODE_1331_length_2655_cov_63.920151
    >NODE_1395_length_1978_cov_42.813953
    ...

    I found 689 contigs have tail-to-tail matches with each other by doing BLAST, such as
    NODE_1331_length_2655_cov_63.920151: 2656 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 2699
    ||||||||||||||||||||||||||||||||||||||||||||
    NODE_1395_length_1978_cov_42.813953: 2022 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 1979


    Can anyone tell me why didn't velvet merge those overlaps? Is that correct for me to join contigs into larger contigs? Thank you!

  • #2
    Originally posted by hard998 View Post
    Hi, I did a denovo assembly using velvet 1.2.03 which gave me 1626 contigs,

    However, when I examined the contig.fa output by velvet, eg
    >NODE_1331_length_2655_cov_63.920151
    >NODE_1395_length_1978_cov_42.813953
    ...

    I found 689 contigs have tail-to-tail matches with each other by doing BLAST, such as
    NODE_1331_length_2655_cov_63.920151: 2656 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 2699
    ||||||||||||||||||||||||||||||||||||||||||||
    NODE_1395_length_1978_cov_42.813953: 2022 tgcggctggtcggctcgtcgcaggcgaacatgttcgcctccatc 1979


    Can anyone tell me why didn't velvet merge those overlaps? Is that correct for me to join contigs into larger contigs? Thank you!
    These are called repeats. You probably have more than 2 contigs with this sequence on one end. Therefore, Velvet did not merge them because that would cause an assembly error, which produce chimeric contigs.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Current Approaches to Protein Sequencing
      by seqadmin


      Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
      04-04-2024, 04:25 PM
    • seqadmin
      Strategies for Sequencing Challenging Samples
      by seqadmin


      Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
      03-22-2024, 06:39 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 04-11-2024, 12:08 PM
    0 responses
    16 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 10:19 PM
    0 responses
    21 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-10-2024, 09:21 AM
    0 responses
    16 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 04-04-2024, 09:00 AM
    0 responses
    46 views
    0 likes
    Last Post seqadmin  
    Working...
    X