Small rna pipeline

[empyrean]

hi..

I am working on small rna sequencing which was sequenced through illumina hiseq. the read length i got was 30bp. When i removed 3' adapter, i see that 90% of the reads are having 30bp. I tried with cutadapt, fastq-mcf tools but the result didnt change, peaking at 30bp. The adapter i got is correct adapter according to sequencing lab. When i look at other papers, everyone report that the peak is around 21- 24 bp.. can anyone suggest what steps i can do to process my data?

[CharlesJB]

If your read length is 30bp and the expected length is around 21-24bp, then you should look for the first 6-9bp of the adapter and not the whole adaptor.

[empyrean]

thank you for the reply..
i did look for that using 5' adapter and it did not help either..

[maasha]

In Biopieces (www.biopieces.org) there is a tool called find_adaptor which allows removal of partial adaptors and was written specifically for this problem.

[CharlesJB]

First, you should check manually your sequences to see if you always see the same 6-9bp sequence at the end and to confirm that you are using the correct adaptor sequence. For instance, if you expect the first 6 nucleotides of your adaptor to be ACGTGT and your file containing the sequences is named Reads.fastq:

grep ACGTGT Reads.fastq | wc -l

If the number you get is not close to the total number of reads, you might not be looking for the right sequence.

[micans]

We wrote a tool called 'reaper' that is able to strip adapter sequence, including partial matches at the end. It comes with another program called 'minion' that can be used to deduce an adapter sequence from sequencing data. These tools are part of our 'Kraken' next-gen sequencing set of tools: http://www.ebi.ac.uk/research/enright/software/kraken. Extensive documentation is provided, but we can also advise.

[ecSeq Bioinformatics]

Is this the adapter you tried to clip?

TGGAATTCTCGGGTGCCAAGGAACTCCAGTCAC

[empyrean]

thank you for your advices, thats what minion fount from my data as well when i searched for adapter.