Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • nasepu
    Junior Member
    • Sep 2012
    • 5

    #1

    Interrogate .fq file for specific sequence?

    I found a very suspect major snp when digging through my sequence data, identical to a construct I've previously made in the lab. I'm concerned this is contamination, and it has too significant a phenotype to be ignored. The best way I could think to check if the plasmid somehow made its way in is to check for other stuff that would be on a plasmid, like ampicillin or kanamycin resistance.

    I'm unsure what the best way to go about this is. I briefly tried aligning the entire .fq file against the amp gene sequence, which threw an error that can probably be fixed, but the whole idea of trying to align billions of reads against one tiny gene rubbed me the wrong way. Is there a better way to go about this/any tools that would be more useful?
  • Bukowski
    Senior Member
    • Jan 2010
    • 388

    #2
    On the grounds of 'right tool for the right job' using an aligner specifically designed to align ngs reads to a sequence seems like the right way to go to me, as it's likely to be faster than (e.g.) BLAT.

    With such a small search space it doesn't seem like the job would take that long - why not try aligning to the vector sequence not just the gene?

    Comment

    • swbarnes2
      Senior Member
      • May 2008
      • 910

      #3
      Try:

      Code:
      grep AGTTAGCTCTCGATAGGCTAT read1.fq
      For whatever sequence you are looking for.

      Comment

      Latest Articles

      Collapse

      • SEQadmin2
        Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
        by SEQadmin2



        CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

        Despite this, “CRISPR helped turn genome editing from a specialized technique into
        ...
        07-31-2026, 11:01 AM
      • SEQadmin2
        Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
        by SEQadmin2


        Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

        The systematic characterization of the human proteome has
        ...
        07-20-2026, 11:48 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by SEQadmin2, Today, 10:35 AM
      0 responses
      4 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 08-06-2026, 07:41 AM
      0 responses
      23 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 08-03-2026, 10:13 AM
      0 responses
      41 views
      0 reactions
      Last Post SEQadmin2  
      Started by SEQadmin2, 07-31-2026, 02:55 AM
      0 responses
      47 views
      0 reactions
      Last Post SEQadmin2  
      Working...