[PERL] Text files manipulation/reorganisation

[Kawaccino]

Hello everyone,
guess what, I got a question! Here it is:
I got two files organised a little like fasta files (but they are txt files), that look like this:
>1 count:272019
TACCTGGTTGATCCTGCCAG
>2 count:48613
TTTGGATTGAAGGGAGCTCTA
>3 count:15422
TTTGGATTGAAGGGAGCTCT
>4 count:9818
TTGGACTGAAGGGAGCT
>5 count:8783
TTGGACTGAAGGGAGCTCCCT
These two files contain the same sequences and some sequences that are only in one of the files; these sequences are not in the same order in the two files and for an identical sequence, the count value isn't the same in the two files. What I want to do is order the two files so that the sequences are in the same order in each of them. I also want to modify the name, so that it consists only of the value of count. In fact, what I want to obtain is, for example:
272019
TACCTGGTTGATCCTGCCAG
48613
TTTGGATTGAAGGGAGCTCTA
15422
TTTGGATTGAAGGGAGCTCT
9818
TTGGACTGAAGGGAGCT
8783
TTGGACTGAAGGGAGCTCCCT
I also want that if a sequence is only in file1 for exemple, in file2 that sequence appears but with a count value of 0. Same thing if the sequence is only in file2, I want that in file1 it appears with a count value of 0.
So i wrote a script that seems to work for sorting my sequences in the same order in the two files; I say seems to work cause now, the two files have the same nomber of lines of sequences and they are in the same order.
But I have a problem: I don't know how to extract the count value and keep it associated with its sequence and how to say I want this value to be 0 if my sequence is only in one file. Cause, if I understood well the principle of hash, with my sequences having a different count value in each file, I can't do a

if (exists $results{$count}
{
   $results{$count}++;
}

It only works for identical values, no?

Well all that to say I'm lost and blocked on this part of my script, so if anyone can help me, I will really appreciate it. Thank you very much.

By the way, here is the code I wrote, that works for sorting my sequences (if anybody thinks this code is not really good and could be optimised, don't hesitate to tell!):

use warnings;
use strict;
my $fast1="C:/Users/Moi/fichier1.fasta";
open (my $IN1, "<", $fast1) or die "Impossible d'ouvrir le fichier $fast1 $!";
my $fast2="C:/Users/Moi/fichier2.fasta";
open (my $IN2, "<", $fast2) or die "Impossible d'ouvrir le fichier $fast2 $!";
my $trie1="C:/Users/Moi/fichier1bis.fasta";
open (my $OUT1, ">", $trie1) or die "Impossible d'ouvrir le fichier $trie1 $!";
my $trie2="C:/Users/Moi/fichier2bis.fasta";
open (my $OUT2, ">", $trie2) or die "Impossible d'ouvrir le fichier $trie2 $!";
my %results;
#my @tab;
my ($name, $line);
while($name = <$IN1> )
{
    $line=<$IN1>;
    chomp $name;
    chomp $line;
    #@tab = split (/:/, $name);
    #$count=$tab[1];
    $results{$line}=1;
}
while($name = <$IN2>)
{
    $line=<$IN2>;
    chomp $name;
    chomp $line;
    #@tab = split (/:/, $name);
    #$count=$tab[1];
    if (exists $results{$line})
    {
        $results{$line}++;
    }
}
foreach $line (keys %results)
{
   if ($results{$line} == 1)
   {
        print $OUT1 "$line\n";
   }
   if ($results{$line}==2)
   {
        print $OUT1 "$line\n";
        print $OUT2 "$line\n";
   }
  else
  {
        print $OUT2 "$line\n";
   }
}
close ($IN1);
close ($IN2);
close ($OUT1);
close ($OUT2);

The commented lines are an idea I got to extract my count values, but I didn't see how to continue on it, so...

Once again, thanks for any help you can give me!
Have a nice day!

[mastal]

PERL] Text files manipulation/reorganisation

Hi,

I would use a hash of arrays.

So you would have $results{$line}->[0] would be 1 for sequences that
are found in file1 ($results{$line}->[0] = 1),

and

$results{$line}->[1] would be 1 for sequences that
are found in file2 ($results{$line}->[1] = 1).

when you read through the first file, you could set the counts for that sequence in the second file to 0 ($results{$line}->[1] = 0).

Then when you are reading through the second file, check if that sequence already exits, if it doesn't, set the count for file1 to 0 ($results{$line}->[0] = 0).

When you print the contents of the hash, if ($resuilts{$line}->[0] is 0, print that line to output file to only, etc.

Hope this helps,
maria

[Kawaccino]

Thanks for your answer but I have some questions on it: the way I understand it, I will only have the unique sequences in my output file,no? Sorry i'm a newbie in Perl, still learning and sometimes even evident things are not so evident for me...
In fact I don't understand how the hash af array will allow me to save the count value and keep it associated with the corresponding sequence.

[mastal]

[PERL] Text files manipulation/reorganisation

You're right, I forgot that you need to have the counts associated with your
sequence.

But the hash of arrays will still work:


When you read through file 1,

$results{$line}->[0] = $name;
$results{$line}->[1] = 0;

When you read through file 2,

if (exists $line){
$results{$line}->[1] = $name;
}
else{
$results{$line}->[0] =0;
$results{$line}->[1] = $name;
}

when you go through the hash to print the two output files,
do something like:

foreach $line (keys %results){

print OUT1 "$line\t $results{$line}->[0]\n";
print OUT2 "$line\t $results{$line}->[1]\n";
}


the hash keys are unique, but the values associated with each key are (anonymous) arrays instead of single (scalar) values.

so you store the counts for file1 at position [0] of each array, and the counts for file2 qt position [1] of each array.

hopefully this should work.

[Kawaccino]

Oh ok! Thank you so much, I understand how it works now. I will try to write the script, thank you!

Here I am again: I did as you told me an it works perfectly! So once again thank you Maria and thank your for the explanations of what you told me cause now, I know it works and I wil be able to use it for something else if I need.