Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • dsher
    Member
    • Feb 2013
    • 23

    Retrieving sequence parts using blastdbcmd

    Hi all

    I am trying to retrieve nucleotide ranges from a BLAST database using blastdbcmd with the -entry_batch option. According to the user manual, blastdbcmd can work with input ranges (in "start-end" format) as well as with strand ("plus/minus"). The query file looks like this:

    comp185406_c0_seq1 1374-1472
    comp185740_c0_seq1 405-506

    When I run blastdbcmd I get the following error:
    Error: comp185406_c0_seq1 1374-1472: OID not found
    Error: comp185740_c0_seq1 405-506: OID not found

    I don't get the error if I use only the sequence IDs and not with nucleotide ranges. I have tried adding "-entry" and "-range" to the input file but this does not help.

    Any suggestions? I am doing this on a windows machine using blast 2.2.25+

    Thanks
    Daniel
  • Apexy
    Member
    • Apr 2011
    • 62

    #2
    Its likely that this issue has already been address here: http://seqanswers.com/forums/showthread.php?t=22415

    HTH

    Comment

    • dsher
      Member
      • Feb 2013
      • 23

      #3
      Hi HTH - the same questions was asked there three years ago but the issue has not been solved. Any suggestions?
      Daniel

      Comment

      • Apexy
        Member
        • Apr 2011
        • 62

        #4
        Hi Dsher,

        I don't have a direct answer for this as I have not used blastdbcmd lately. Could the problem be related to this? Let me know if this helps while waiting from someone who is familiar with the problem to chip in something.
        The blastdbcmd tool in the BLAST+ suite (replacing fastacmd in the C 'legacy' BLAST suite) lets you do a lot of clever things with a BLAST d...

        Comment

        • GenoMax
          Senior Member
          • Feb 2008
          • 7142

          #5
          Wonder if this is windows specific problem. On unix:

          Code:
          blastdbcmd -db refseq_rna -entry_batch range.txt -outfmt "%f" -out test_query.txt
          
          $ more range.txt 
          nm_000249 100-150
          nm_000249 150-200

          Here is the output:

          $ more test_query.txt
          >gi|263191547|ref|NM_000249.3|:100-150 Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH 1), transcript variant 1, mRNA
          ACAGCTGAAGGAAGAACGTGAGCACGAGGCACTGAGGTGATTGGCTGAAGG
          >gi|263191547|ref|NM_000249.3|:150-200 Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH 1), transcript variant 1, mRNA
          GCACTTCCGTTGAGCATCTAGACGTTTCCTTGGCTCTTCTGGCGCCAAAAT
          Last edited by GenoMax; 05-20-2013, 03:49 AM.

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            Cancer Drug Resistance: The Lingering Barrier to Rising Survival
            by SEQadmin2



            Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

            There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
            Yesterday, 05:17 AM
          • GATTACAT
            Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by GATTACAT
            Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
            07-01-2026, 11:43 AM
          • SEQadmin2
            Nine Things a Sample Prep Scientist Thinks About Before Sequencing
            by SEQadmin2


            I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

            Here are nine questions we think about, in roughly the order they matter, before...
            06-18-2026, 07:11 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Yesterday, 10:08 AM
          0 responses
          6 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-07-2026, 11:05 AM
          0 responses
          8 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 07-02-2026, 11:08 AM
          0 responses
          31 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-30-2026, 05:37 AM
          0 responses
          29 views
          0 reactions
          Last Post SEQadmin2  
          Working...