Retrieving sequence parts using blastdbcmd

[dsher]

Hi all

I am trying to retrieve nucleotide ranges from a BLAST database using blastdbcmd with the -entry_batch option. According to the user manual, blastdbcmd can work with input ranges (in "start-end" format) as well as with strand ("plus/minus"). The query file looks like this:

comp185406_c0_seq1 1374-1472
comp185740_c0_seq1 405-506

When I run blastdbcmd I get the following error:
Error: comp185406_c0_seq1 1374-1472: OID not found
Error: comp185740_c0_seq1 405-506: OID not found

I don't get the error if I use only the sequence IDs and not with nucleotide ranges. I have tried adding "-entry" and "-range" to the input file but this does not help.

Any suggestions? I am doing this on a windows machine using blast 2.2.25+

Thanks
Daniel

[Apexy]

Its likely that this issue has already been address here: http://seqanswers.com/forums/showthread.php?t=22415

HTH

[dsher]

Hi HTH - the same questions was asked there three years ago but the issue has not been solved. Any suggestions?
Daniel

[Apexy]

Hi Dsher,

I don't have a direct answer for this as I have not used blastdbcmd lately. Could the problem be related to this? Let me know if this helps while waiting from someone who is familiar with the problem to chip in something.

http://blastedbio.blogspot.com/2012/10/my-ids-not-good-enough-for-ncbi-blast.html

[GenoMax]

Wonder if this is windows specific problem. On unix:

blastdbcmd -db refseq_rna -entry_batch range.txt -outfmt "%f" -out test_query.txt

$ more range.txt 
nm_000249 100-150
nm_000249 150-200

Here is the output:

$ more test_query.txt
>gi|263191547|ref|NM_000249.3|:100-150 Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH 1), transcript variant 1, mRNA
ACAGCTGAAGGAAGAACGTGAGCACGAGGCACTGAGGTGATTGGCTGAAGG
>gi|263191547|ref|NM_000249.3|:150-200 Homo sapiens mutL homolog 1, colon cancer, nonpolyposis type 2 (E. coli) (MLH 1), transcript variant 1, mRNA
GCACTTCCGTTGAGCATCTAGACGTTTCCTTGGCTCTTCTGGCGCCAAAAT