Tophat2/prep_reads error: unrecognized option '--max-seg-multihits'

[JonB]

I know there are several posts about 'prep_reads', but they concern the Sanger/Phred quality issue. I think mye problem is different.

I am trying to map single-end illumina reads. They are sequenced with the CASAVA 1.8 and later pipeline, so I have kept the default values regarding quality scores.

I have mapped such reads without problems before, but now I always get error at the prep_reads stage:

[2013-06-02 12:53:23] Beginning TopHat run (v2.0.7)
-----------------------------------------------
[2013-06-02 12:53:23] Checking for Bowtie
                  Bowtie version:        2.0.6.0
[2013-06-02 12:53:23] Checking for Samtools
                Samtools version:        0.1.18.0
[2013-06-02 12:53:23] Checking for Bowtie index files
[2013-06-02 12:53:23] Checking for reference FASTA file
[2013-06-02 12:53:23] Generating SAM header for sycon-genome
        format:          fastq
        quality scale:   phred33 (default)
[2013-06-02 12:53:24] Preparing reads
        [FAILED]
Error running 'prep_reads'
Usage:   prep_reads <reads1.fa/fq,...,readsN.fa/fq>

And inside the prep_reads log:

/cluster/home/jonbra/bin/prep_reads: unrecognized option '--max-seg-multihits'

Any tips on what is wrong?

[mastal]

Tophat2/prep_reads error: unrecognized option '--max-seg-multihits'

What was the command you used to run Tohat?

[JonB]

tophat2 -p 8 --library-type fr-firststrand -o /output genome-file /seq-data.fastq

And here's a sample of the sequence data:

@HWI-ST486:386:D1UMHACXX:3:1101:1440:2126 1:N:0:ACAGTG
NTAACATTGTTTAAATGGAGAAAATAACCGTATGAAGAAGTTAATGAAGTTAATGCTGCTGGCAAGTGCCAGTTTAACCGTGGGTTGTGCAACATCTGATA
+
#11AA1B?BDA<BDB9ACFCFFIC4FFCF>)8CC:?D9?D:9BDDDDEEDDIA>D9?DEIC=CACDCEEC7=ACEEDDDA??@<35?81>>>A99::>AAA
@HWI-ST486:386:D1UMHACXX:3:1101:1389:2165 1:N:0:ACAGTG
AACTTTTAACGGTGGATCTCTTGGCTCGTGGATCGATGAAGAAAGCAGCAAACTGCGATACGTAGTGTGAATTGCAGAATTCAGTGAATCATCGAATTTTT
+
@@?DDBBDF<FFFIIBGEHAEHIE3A<?DAF=@0??B<DFD<D/9.)88CCF>@CCE'=<B?73;;3;@(;B@:5((5>@BA:>5:(;3:A>@99?A####
@HWI-ST486:386:D1UMHACXX:3:1101:1363:2167 1:N:0:ACAGTG
TTTATTTGGTTAGGGCTGAGGTAGTGACAAGTTCACTACCTCTTTTAAAAAAAACAAAAAAAAAAAAAAAAAAAAAAAATGGAAGGACAAAACGCTTCACC
+
@@@DDDDDHHHDHIIIIIIGIB3AABA4?CC?C??BD<?;B<?FGI<DCGGEEHIIFHFHEBBBBBBBB@@BBBB##########################

[JonB]

I think maybe the problem is that I have sequenced small RNAs, and my reads are all 100 bps. I forgot to trim the Poly-A stretches and low quality bases...

Also I think I only need to run Bowtie and not Tophat, as I do not expect spliced small RNAs.

[JonB]

I talking mostly to myself here... but I solved the problem (or at least it works now).

I forgot that I had sequenced smallRNAs, so I had to remove Poly-A stretches from the oligodT probe and other sequence on the 5'-end (sometimes it was sequenced all the way through the Poly-A stretch).

And I also mapped using bowtie2 instead of Tophat2. No need to look for splice junctions when I have smallRNA data I reckon.