TopHat2 error running 'prep_reads'

[Kaskar]

Dear community,

I have a problem with prep_reads running TopHat2, like so many other. I have looked at all previous threads, and that solved my problem only partly.

I had 12 multiplexed RNA samples that I ran on 6 lanes on an Illumina HiSeq2000. After retrieving the data I made a custom program to demultiplex the samples and combine the data from the 6 lanes. On the resulting fastq files I tried to run TopHat. First I used:

/tophat/tophat2 -o TophatOutput_sample -p 4 /Bowtie2index/hg19 sample.fq

That worked for 8 out of 12 samples. After reading a bit on this forum I realized that I had phred quality score 64, so I added --solexa1.3-quals. That solved the issue for another three samples, but still I cannot run TopHat on the last sample. I receive the following error message for that sample:

[2013-05-28 22:02:25] Beginning TopHat run (v2.0.8b)
-----------------------------------------------
[2013-05-28 22:02:25] Checking for Bowtie
Bowtie version: 2.1.0.0
[2013-05-28 22:02:25] Checking for Samtools
Samtools version: 0.1.9.0
[2013-05-28 22:02:25] Checking for Bowtie index files
[2013-05-28 22:02:25] Checking for reference FASTA file
[2013-05-28 22:02:25] Generating SAM header for /data/genomes/hg19/genome/Bowtie2index/hg19
format: fastq
quality scale: phred64 (reads generated with GA pipeline version >= 1.3)
[2013-05-28 22:02:30] Preparing reads
[FAILED]
Error running 'prep_reads'
---------------------------

My prep_reads.log is empty.

I would be very happy if anyone could tell me how to solve the problem!

[Kaskar]

Problem solved.

Instead of running TopHat2 I ran Bowtie2 directly on the problematic fq file. Bowtie2 gave a much more concrete error message. It turned out that in the middle of the file I had a huge repeat of /xoo/xoo. I have no idea how it came there, but I reran my previous custom code, and after that it all worked as it should.

[kmcarr]

Problem solved.

Instead of running TopHat2 I ran Bowtie2 directly on the problematic fq file. Bowtie2 gave a much more concrete error message. It turned out that in the middle of the file I had a huge repeat of /xoo/xoo. I have no idea how it came there, but I reran my previous custom code, and after that it all worked as it should.

For future reference, the messages reported to the terminal during a Tophat run are only a minimal summary of the information reported by the underlying programs which Tophat runs. Tophat keeps the much more complete logs of each program in the <output_directory>/logs directory. When your Tophat run failed during Bowtie you could have checked the bowtie log in the logs directory for more detailed information.

[aforntacc]

ok guys please i need some help
i am very very new to tophat, bowtie samtool colabo.
i had this error below can some one please explain to me
thanks

prep_reads v2.0.0 (3280)
---------------------------
Error: qual length (131) differs from seq length (100) for fastq record HWI-ST365_0157:7:2101:9222:152711#GCGGTC/2!

gzip: stdout: Broken pipe

[mastal]

TopHat2 error running 'prep_reads'

Have a look at the record for the read mentioned in the error message,
and see if there is anything obviously wrong with your file.

Is there some character that your computer system doesn't like
and is interpreting as a return character, or is it missing a return character
at the end of one of the lines?

[aforntacc]

ok i have checked the record of the error message, here
@HWI-ST365_0157:7:2101:9222:152711#GCGGTC/2
CTGCACCAGCCCGTCGAAGACACATCAGTGACTCCATCATGACTTTTTCTTCATCAATCATTTTGAGAACAGCACCAGCCTTGATCATCGAGTATTCACC
+HWI-ST365_0157:7:2101:9222:152711#GCGGTC/2
_bbeeeeeg^ecggfhhiiffhihihihffggiihgfhhbghifiidgefdeghffhhiiiiiiiefegga_cebcbcca^`bcccdccb`a``_bcY_b

thay are both 100 i do not know why the error.
i am viturlizing ubuntu on windows 7, could this be an issue?
kindly assist