Hi everybody !!!!
We want to use this 3 programs (MAQGene -> SAMTools -> IGV) to display a lot of fragments of a mutant sequence of C. elegans aligned with a reference sequence.
First we run MAQGene to have all the difference between our fragments and the reference. We have a txt file with all the informations like this :
Then we get the map file and convert it into a sam file to be able to use SAMTools to generate an alignment.
First I index the reference fasta file
---> Now I have a doubt, the fasta file have the reference sequence of 5 chromosom each with a name (I,II,III,...) It seems to take only I ? no ?
So I try to convert the sam into a bam
But more ofently I have this error message
Certainly rights problems.
What is going wrong with the sam file ? Is it in a good format ? Is it the conversion map->sam that is not good ?
If someone could help me it will be very good because I'm lost
If you want more informations tell me !
Bye
We want to use this 3 programs (MAQGene -> SAMTools -> IGV) to display a lot of fragments of a mutant sequence of C. elegans aligned with a reference sequence.
First we run MAQGene to have all the difference between our fragments and the reference. We have a txt file with all the informations like this :
Code:
variant_id mutant_strain dna start reference_base sample_base consensus_score loci_multiplicity mapping_quality neighbor_quality number_wildtype_reads number_variant_reads sequencing_depth sample_reads variant_type indel_size classes descriptions parent_features
14 fr6_34 I 200948 A T 186 0.81 63 62 0 8 8 @TttTttTt point 0 SNP none {haw293}
15 fr6_34 I 200949 C T 191 0.81 63 62 0 8 8 @TttTttTt point 0 SNP none {haw294}
First I index the reference fasta file
Code:
[Elegans@localhost MaqToSam]$ ../samtools faidx c_elegans.WS200.dna.fa [Elegans@localhost MaqToSam]$ head c_elegans.WS200.dna.fa.fai I 15072421 3 50 51
So I try to convert the sam into a bam
Code:
[Elegans@localhost MaqToSam]$ ../samtools view -bS -T c_elegans.WS200.dna.fa fr6_34.sam -o fr6_34.bam [samopen] no @SQ lines in the header. [main_samview] random alignment retrieval only works for indexed BAM files.
Code:
[Elegans@localhost MaqToSam]$ ../samtools view -S fr6_34.sam [main_samview] fail to open file for reading. [Elegans@localhost MaqToSam]$ ll total 7677116 -rw-rw-r-- 1 Elegans root 15373873 2009-12-01 11:28 c_elegans.WS200.dna.fa -rw-rw-r-- 1 Elegans Elegans 19 2009-12-09 15:03 c_elegans.WS200.dna.fa.fai -rwxrwxrwx 1 Elegans root 1705085078 2009-12-02 13:54 fr6_34.map -rwxrwxrwx 1 Elegans Elegans 6133132406 2009-12-09 13:27 fr6_34.sam
What is going wrong with the sam file ? Is it in a good format ? Is it the conversion map->sam that is not good ?
Code:
[Elegans@localhost MaqToSam]$ head fr6_34.sam HWI-EAS337:7:59:98:1562#0 65 I 1 0 76M * 0 0 GCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCT :ACA6BB@CA9?7752A?<A<@>*4<B?8@==@A??=/758=8=?667B;<=A@815(:3&<;58A3%%%%%%%%% MF:i:32 AM:i:0 SM:i:0 NM:i:0 UQ:i:0 H0:i:85 H1:i:85 HWI-EAS337:7:1:605:1394#0 115 I 1 0 76M * 0 -67 GCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCT 8??A?,,,B;8=C;7;6:@<>@<@CA>@A>@B@C>B@BBCAACBBA>C65:7@B?B@C?@AA>BBBB46@<AA69A MF:i:20 AM:i:0 SM:i:0 NM:i:0 UQ:i:0 H0:i:85 H1:i:85 HWI-EAS337:7:19:1100:983#0 115 I 1 0 76M * 0 -75 GCCTAAGCCTATGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCT =98>:<<?<A<!8=AA::A@=?AB?AACBAABCB?BBB?B?BBBBBBC@BCBB@BBBCABCBBBCCCBBCBBCBBB MF:i:20 AM:i:0 SM:i:0 NM:i:1 UQ:i:0 H0:i:85 H1:i:85 HWI-EAS337:7:45:645:884#0 115 I 1 0 76M * 0 -75 GCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCT :.:;33-=6?=5=<??;9ABB>3=BBA:4:@B=A;9@AAC?BBBBBBBCBBBBBAABBBBBBBBCBB>@B@BBABB MF:i:20 AM:i:0 SM:i:0 NM:i:0 UQ:i:0 H0:i:85 H1:i:85 HWI-EAS337:7:74:1510:749#0 179 I 1 0 76M * 0 -75 GCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCT %%%%%%66=;6/;6;4-/7=:64<;=A@AA?AAABBB@BAAB@A@BA@@B??BBBBBBBB=@BBBBBBBBBBBBBB MF:i:20 AM:i:0 SM:i:0 NM:i:0 UQ:i:0 H0:i:85 H1:i:85 HWI-EAS337:7:74:1510:749#0 67 I 2 0 76M * 0 75 CCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGNCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTA BCCCCBACCCCCBCCCCCACCCCCBBCCCB@=CCBBCBCCC?!<CCCA@=CCB@@?B@B=?=ACCA>>BB?=47>B MF:i:20 AM:i:0 SM:i:0 NM:i:1 UQ:i:0 H0:i:85 H1:i:60 HWI-EAS337:7:19:1100:983#0 131 I 2 0 76M * 0 75 CCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTNAGCCTA BABBB@BB@BBABB@BB??A@BB@@@=BB?=A@@@;?<6A?<<@;>:7>732>%%%%%%%%%%%%%%%%!%%%%%% MF:i:20 AM:i:0 SM:i:0 NM:i:1 UQ:i:0 H0:i:85 H1:i:85 HWI-EAS337:7:43:1192:1944#0 163 I 2 0 76M * 0 79 CCTAAGCCTAAGCCTAAGCCTAAGNCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCCAAGCCCAAGCCTCAGTCCA BBCBBBABA>9=BB@?9??@7>@3!;:2/6%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%% MF:i:18 AM:i:0 SM:i:0 NM:i:6 UQ:i:20 H0:i:0 H1:i:85 HWI-EAS337:7:64:839:1206#0 99 I 2 0 76M * 0 81 CCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTA BBBBC:@BBBCBBBABB@BAABB;BB@BBABBABCB@A?>?>@B<@B@A;>9A;?=<AB7?>39>:5;5=94:A/; MF:i:18 AM:i:0 SM:i:0 NM:i:0 UQ:i:0 H0:i:85 H1:i:62 HWI-EAS337:7:45:645:884#0 131 I 2 0 76M * 0 75 CCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCCAAGCCTAAGCCTA BABB=<@<@B?=BA?B=?@A?=A;@A@AB<8@;<5;??89959;27=69%%%%%%%%%%%%%%%%%%%%%%%%%%% MF:i:20 AM:i:0 SM:i:0 NM:i:1 UQ:i:4 H0:i:85 H1:i:85
If you want more informations tell me !
Bye
! But I have the same error messages ....
Comment