Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • Fred13
    Junior Member
    • Nov 2009
    • 9

    MAQGene -> SAMTools -> IGV

    Hi everybody !!!!

    We want to use this 3 programs (MAQGene -> SAMTools -> IGV) to display a lot of fragments of a mutant sequence of C. elegans aligned with a reference sequence.
    First we run MAQGene to have all the difference between our fragments and the reference. We have a txt file with all the informations like this :

    Code:
    variant_id	mutant_strain	dna	start	reference_base	sample_base	consensus_score	loci_multiplicity	mapping_quality	neighbor_quality	number_wildtype_reads	number_variant_reads	sequencing_depth	sample_reads	variant_type	indel_size	classes	descriptions	parent_features
    14	fr6_34	I	200948	A	T	186	0.81	63	62	0	8	8	@TttTttTt	point	0	SNP	none	{haw293}
    15	fr6_34	I	200949	C	T	191	0.81	63	62	0	8	8	@TttTttTt	point	0	SNP	none	{haw294}
    Then we get the map file and convert it into a sam file to be able to use SAMTools to generate an alignment.

    First I index the reference fasta file
    Code:
    [Elegans@localhost MaqToSam]$ ../samtools faidx c_elegans.WS200.dna.fa
    [Elegans@localhost MaqToSam]$ head c_elegans.WS200.dna.fa.fai
    I       15072421        3       50      51
    ---> Now I have a doubt, the fasta file have the reference sequence of 5 chromosom each with a name (I,II,III,...) It seems to take only I ? no ?

    So I try to convert the sam into a bam
    Code:
    [Elegans@localhost MaqToSam]$ ../samtools view -bS -T c_elegans.WS200.dna.fa fr6_34.sam -o fr6_34.bam
    [samopen] no @SQ lines in the header.                                                             
    [main_samview] random alignment retrieval only works for indexed BAM files.
    But more ofently I have this error message
    Code:
    [Elegans@localhost MaqToSam]$ ../samtools view -S fr6_34.sam
    [main_samview] fail to open file for reading.
    [Elegans@localhost MaqToSam]$ ll
    total 7677116
    -rw-rw-r-- 1 Elegans root      15373873 2009-12-01 11:28 c_elegans.WS200.dna.fa
    -rw-rw-r-- 1 Elegans Elegans         19 2009-12-09 15:03 c_elegans.WS200.dna.fa.fai
    -rwxrwxrwx 1 Elegans root    1705085078 2009-12-02 13:54 fr6_34.map
    -rwxrwxrwx 1 Elegans Elegans 6133132406 2009-12-09 13:27 fr6_34.sam
    Certainly rights problems.

    What is going wrong with the sam file ? Is it in a good format ? Is it the conversion map->sam that is not good ?

    Code:
    [Elegans@localhost MaqToSam]$ head fr6_34.sam
    HWI-EAS337:7:59:98:1562#0       65      I       1       0       76M     *       0       0       GCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCT :ACA6BB@CA9?7752A?<A<@>*4<B?8@==@A??=/758=8=?667B;<=A@815(:3&<;58A3%%%%%%%%%    MF:i:32 AM:i:0  SM:i:0  NM:i:0       UQ:i:0  H0:i:85 H1:i:85
    HWI-EAS337:7:1:605:1394#0       115     I       1       0       76M     *       0       -67     GCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCT 8??A?,,,B;8=C;7;6:@<>@<@CA>@A>@B@C>B@BBCAACBBA>C65:7@B?B@C?@AA>BBBB46@<AA69A    MF:i:20 AM:i:0  SM:i:0  NM:i:0       UQ:i:0  H0:i:85 H1:i:85
    HWI-EAS337:7:19:1100:983#0      115     I       1       0       76M     *       0       -75     GCCTAAGCCTATGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCT =98>:<<?<A<!8=AA::A@=?AB?AACBAABCB?BBB?B?BBBBBBC@BCBB@BBBCABCBBBCCCBBCBBCBBB    MF:i:20 AM:i:0  SM:i:0  NM:i:1       UQ:i:0  H0:i:85 H1:i:85
    HWI-EAS337:7:45:645:884#0       115     I       1       0       76M     *       0       -75     GCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCT :.:;33-=6?=5=<??;9ABB>3=BBA:4:@B=A;9@AAC?BBBBBBBCBBBBBAABBBBBBBBCBB>@B@BBABB    MF:i:20 AM:i:0  SM:i:0  NM:i:0       UQ:i:0  H0:i:85 H1:i:85
    HWI-EAS337:7:74:1510:749#0      179     I       1       0       76M     *       0       -75     GCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCT %%%%%%66=;6/;6;4-/7=:64<;=A@AA?AAABBB@BAAB@A@BA@@B??BBBBBBBB=@BBBBBBBBBBBBBB    MF:i:20 AM:i:0  SM:i:0  NM:i:0       UQ:i:0  H0:i:85 H1:i:85
    HWI-EAS337:7:74:1510:749#0      67      I       2       0       76M     *       0       75      CCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGNCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTA BCCCCBACCCCCBCCCCCACCCCCBBCCCB@=CCBBCBCCC?!<CCCA@=CCB@@?B@B=?=ACCA>>BB?=47>B    MF:i:20 AM:i:0  SM:i:0  NM:i:1       UQ:i:0  H0:i:85 H1:i:60
    HWI-EAS337:7:19:1100:983#0      131     I       2       0       76M     *       0       75      CCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTNAGCCTA BABBB@BB@BBABB@BB??A@BB@@@=BB?=A@@@;?<6A?<<@;>:7>732>%%%%%%%%%%%%%%%%!%%%%%%    MF:i:20 AM:i:0  SM:i:0  NM:i:1       UQ:i:0  H0:i:85 H1:i:85
    HWI-EAS337:7:43:1192:1944#0     163     I       2       0       76M     *       0       79      CCTAAGCCTAAGCCTAAGCCTAAGNCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCCAAGCCCAAGCCTCAGTCCA BBCBBBABA>9=BB@?9??@7>@3!;:2/6%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%%    MF:i:18 AM:i:0  SM:i:0  NM:i:6       UQ:i:20 H0:i:0  H1:i:85
    HWI-EAS337:7:64:839:1206#0      99      I       2       0       76M     *       0       81      CCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTA BBBBC:@BBBCBBBABB@BAABB;BB@BBABBABCB@A?>?>@B<@B@A;>9A;?=<AB7?>39>:5;5=94:A/;    MF:i:18 AM:i:0  SM:i:0  NM:i:0       UQ:i:0  H0:i:85 H1:i:62
    HWI-EAS337:7:45:645:884#0       131     I       2       0       76M     *       0       75      CCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCTAAGCCCAAGCCTAAGCCTA BABB=<@<@B?=BA?B=?@A?=A;@A@AB<8@;<5;??89959;27=69%%%%%%%%%%%%%%%%%%%%%%%%%%%    MF:i:20 AM:i:0  SM:i:0  NM:i:1       UQ:i:4  H0:i:85 H1:i:85
    If someone could help me it will be very good because I'm lost
    If you want more informations tell me !

    Bye
  • lh3
    Senior Member
    • Feb 2008
    • 686

    #2
    Download SAM tools for free. SAM (Sequence Alignment/Map) is a flexible generic format for storing nucleotide sequence alignment. SAMtools provide efficient utilities on manipulating alignments in the SAM format.


    For most unix commands, you MUST put all switches/options before the main arguments. Instead of doing this:

    Code:
    samtools view -bT ref.fa aln.sam -o aln.bam
    do this:

    Code:
    samtools view -bT ref.fa -o aln.bam aln.sam

    Comment

    • Fred13
      Junior Member
      • Nov 2009
      • 9

      #3
      Hi Heng Li,
      OK thanks I don't know why I did that ! But I have the same error messages ....


      Code:
      [Elegans@localhost MaqToSam]$ ../samtools view -bST c_elegans.WS200.dna.fa -o fr6_34.bam ./fr6_34.sam
      [main_samview] fail to open file for reading.
      What kind of error send this type of message ?
      Rights problems ? I made a chmod 777 on the file and try to launch the command with root. --> no changes
      Not a good sam format ? So the maq2sam-long have a problem. Update MAQgene (I didn't make the last update) ? Rights problem when running maq2sam (map file are owned by apache but have 777 rights mode) ?
      Code:
      lrwxrwxrwx 1 apache apache      49 2009-09-02 19:12 fr6_34.map -> /var/www/html/maqgene/maqgene/work/1506135156.map
      Last edited by Fred13; 12-11-2009, 02:11 AM.

      Comment

      • Fred13
        Junior Member
        • Nov 2009
        • 9

        #4
        Hi !!

        So I found the script lines that return this error message :

        Code:
        // open file handlers
              if ((in = samopen(argv[optind], in_mode, fn_list)) == 0) {
                    fprintf(stderr, "[main_samview] fail to open file for reading.\n");
                    goto view_end;
              }
        What are the possibility to make the function samopenn == 0 ??

        I found the samopen function !

        Code:
        samfile_t *samopen(const char *fn, const char *mode, const void *aux)
        {
              samfile_t *fp;
              fp = (samfile_t*)calloc(1, sizeof(samfile_t));
              if (mode[0] == 'r') { // read
                    fp->type |= TYPE_READ;
                    if (mode[1] == 'b') { // binary
                          fp->type |= TYPE_BAM;
                          fp->x.bam = strcmp(fn, "-")? bam_open(fn, "r") : bam_dopen(fileno(stdin), "r");
                          if (fp->x.bam == 0) goto open_err_ret;
                          fp->header = bam_header_read(fp->x.bam);
        There is no restriction with size file ???
        It's very strange I think I'm looking in the wrong way because
        Code:
        [Elegans@localhost MaqToSam]$ ll                                  
        total 15339124                                                    
        -rw-rw-r-- 1 Elegans root      15373873 2009-12-01 11:28 c_elegans.WS200.dna.fa
        -rw-rw-r-- 1 Elegans Elegans         19 2009-12-09 15:03 c_elegans.WS200.dna.fa.fai
        -rwxrwxrwx 1 Elegans root    1705085078 2009-12-02 13:54 fr6_34.map
        [COLOR="Red"]-rwxrwxrwx 1 Elegans Elegans 6133132406 2009-12-09 13:27 fr6_34.sam[/COLOR]
        [Elegans@localhost MaqToSam]$ ../samtools view -S fr6_34.sam
        [COLOR="red"][main_samview] fail to open file for reading.[/COLOR]
        Without any options (just sam input) I have the error. What could be problems with maq2sam-long ?

        help ...
        Last edited by Fred13; 12-11-2009, 02:38 AM.

        Comment

        • naveennav
          Junior Member
          • Jan 2013
          • 1

          #5
          Error found- too late but might help other users

          Too late but might help other users

          It is "-t" option and not "-T" in the samtools view command.
          And also, you have used ref.fa instead of ref.fa.fai in the -t option of your samtools view command.


          Code:
          [Elegans@localhost MaqToSam]$ [B]../samtools view -bS [U][I][B]-T[/B][/I][/U] c_elegans.WS200.dna.[I][U]fa[/U][/I] fr6_34.sam -o fr6_34.bam[/B]
          [samopen] no @SQ lines in the header.                                                             
          [main_samview] random alignment retrieval only works for indexed BAM files.
          Last edited by naveennav; 01-17-2013, 12:05 PM.

          Comment

          • Fred13
            Junior Member
            • Nov 2009
            • 9

            #6
            Thanks !
            To late for me but might help

            Comment

            Latest Articles

            Collapse

            • GATTACAT
              Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
              by GATTACAT
              Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
              07-01-2026, 11:43 AM
            • SEQadmin2
              Nine Things a Sample Prep Scientist Thinks About Before Sequencing
              by SEQadmin2


              I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

              Here are nine questions we think about, in roughly the order they matter, before...
              06-18-2026, 07:11 AM

            ad_right_rmr

            Collapse

            News

            Collapse

            Topics Statistics Last Post
            Started by SEQadmin2, Yesterday, 11:08 AM
            0 responses
            7 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 06-30-2026, 05:37 AM
            0 responses
            11 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 06-26-2026, 11:10 AM
            0 responses
            19 views
            0 reactions
            Last Post SEQadmin2  
            Started by SEQadmin2, 06-17-2026, 06:09 AM
            0 responses
            53 views
            0 reactions
            Last Post SEQadmin2  
            Working...