Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • jmwhitha
    Senior Member
    • Mar 2013
    • 107

    Cuffmerge: No fasta index found for genome.fa...

    Hello all,

    Before running through the TopHat Cufflinks workflow with my own data, I am trying it with Drosophila_melanogaster RNA Seq data (as in "Differential gene and transcript expression analysis of RNA-seq experiments with TopHat and Cufflinks"). Everything seemed to be working until I got to the Cuffmerge step. Executing the following command gave me the following errors.

    cuffmerge -g genes.gtf -s genome.fa -p 8 assemblies.txt

    [Thu Jun 13 11:10:38 2013] Beginning transcriptome assembly merge
    -------------------------------------------

    [Thu Jun 13 11:10:38 2013] Preparing output location ./merged_asm/
    [Thu Jun 13 11:10:40 2013] Converting GTF files to SAM
    [11:10:41] Loading reference annotation.
    [11:10:41] Loading reference annotation.
    [11:10:42] Loading reference annotation.
    [11:10:43] Loading reference annotation.
    [11:10:44] Loading reference annotation.
    [11:10:45] Loading reference annotation.
    [Thu Jun 13 11:10:46 2013] Quantitating transcripts
    You are using Cufflinks v2.1.1, which is the most recent release.
    Command line:
    cufflinks -o ./merged_asm/ -F 0.05 -g genes.gtf -q --overhang-tolerance 200 --library-type=transfrags -A 0.0 --min-frags-per-transfrag 0 --no-5-extend -p 8 ./merged_asm/tmp/mergeSam_fileaFtxQb
    [bam_header_read] EOF marker is absent.
    [bam_header_read] invalid BAM binary header (this is not a BAM file).
    File ./merged_asm/tmp/mergeSam_fileaFtxQb doesn't appear to be a valid BAM file, trying SAM...
    [11:10:46] Loading reference annotation.
    [11:10:49] Inspecting reads and determining fragment length distribution.
    Processed 11337 loci.
    > Map Properties:
    > Normalized Map Mass: 69085.00
    > Raw Map Mass: 69085.00
    > Fragment Length Distribution: Truncated Gaussian (default)
    > Default Mean: 200
    > Default Std Dev: 80
    [11:10:50] Assembling transcripts and estimating abundances.
    Processed 11337 loci.
    [Thu Jun 13 11:11:54 2013] Comparing against reference file genes.gtf
    You are using Cufflinks v2.1.1, which is the most recent release.
    No fasta index found for genome.fa. Rebuilding, please wait..
    Fasta index rebuilt.
    Warning: couldn't find fasta record for '2LHet'!
    Warning: couldn't find fasta record for '2RHet'!
    Warning: couldn't find fasta record for '3LHet'!
    Warning: couldn't find fasta record for '3RHet'!
    Warning: couldn't find fasta record for 'U'!
    Warning: couldn't find fasta record for 'XHet'!
    Warning: couldn't find fasta record for 'YHet'!
    Warning: couldn't find fasta record for 'dmel_mitochondrion_genome'!
    [Thu Jun 13 11:12:07 2013] Comparing against reference file genes.gtf
    You are using Cufflinks v2.1.1, which is the most recent release.
    Warning: couldn't find fasta record for '2LHet'!
    Warning: couldn't find fasta record for '2RHet'!
    Warning: couldn't find fasta record for '3LHet'!
    Warning: couldn't find fasta record for '3RHet'!
    Warning: couldn't find fasta record for 'U'!
    Warning: couldn't find fasta record for 'XHet'!
    Warning: couldn't find fasta record for 'YHet'!
    Warning: couldn't find fasta record for 'dmel_mitochondrion_genome'!


    Checking the genome.fa with head, I found that the problem did not seem to be with the fasta file.
    jmwhitha@jmwhitha-OptiPlex-755:~/my_rnaseq_exp$ head genome.fa
    >2L
    CGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCCCATATTATAGGGAGAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTTTGATTTTTTGGCAACCCAAAATGGTGGCGGATGAACGAGATGATAATATATTCAAGTTGCCGCTAATCAGAAATAAATTCATTGCAACGTTAAATACAGCACAATATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTAATGAGTGCCTCTCGTTCTCTGTCTTATATTACCGCAAACCCAAAAAGACAATACACGACAGAGAGAGAGAGCAGCGGAGATATTTAGATTGCCTATTAAATATGATCGCGTATGCGAGAGTAGTGCCAACATATTGTGCTCTCTATATAATGACTGCCTCTCATTCTGTCTTATTTTACCGCAAACCCAAATCGACAATGCACGACAGAGGAAGCAGAACAGATATTTAGATTGCCTCTCATTTTCTCTCCCATATTATAGGGAGAAATATGAT

    This genome.fa came from http://cufflinks.cbcb.umd.edu/igenomes.html (Drosophila_melanogaster_Ensembl_BDGP5.25.tar.gz).

    So what's the problem?

    Thank you and God bless,
    Jason
  • GenoMax
    Senior Member
    • Feb 2008
    • 7142

    #2
    Index files available from iGenomes appear to have only full chromosomes in the sequences and index files. Special sequences (Heterochromatin in this case, "random" in other genomes) are not included. On the other hand the GTF file seems to contain information about these sequences. That is why you are getting that warning.

    Were you able to complete the execution of cuffmege?

    cross ref this thread from earlier today: http://seqanswers.com/forums/showthread.php?t=31072
    Last edited by GenoMax; 06-13-2013, 09:33 AM.

    Comment

    • jmwhitha
      Senior Member
      • Mar 2013
      • 107

      #3
      Well, now that you mention it, a .fai file was created.

      jmwhitha@jmwhitha-OptiPlex-755:~/my_rnaseq_exp$ head genome.fa.fai
      2L 23011544 4 60 61
      2R 21146708 23395078 60 61
      3L 24543557 44894236 60 61
      3R 27905053 69846857 60 61
      4 1351857 98216998 60 61
      M 19517 99591389 60 61
      X 22422827 99611235 60 61

      Is that all I need?

      Thanks,
      Jason

      Comment

      • jmwhitha
        Senior Member
        • Mar 2013
        • 107

        #4
        Oh, I'm sorry, and a merged.asm was created!

        Comment

        • jmwhitha
          Senior Member
          • Mar 2013
          • 107

          #5
          But now when I do the followup command, I get:

          jmwhitha@jmwhitha-OptiPlex-755:~/my_rnaseq_exp$ cuffdiff -o diff_out -b genome.fa -p 8 -L C1,C2 -u merged_asm/merged.gtf \ ./C1_R1_thout/accepted_hits.bam,./C1_R2_thout/accepted_hits.bam,./C1_R3_thout/accepted_hits.bam \ ./C2_R1_thout/accepted_hits.bam,./C2_R2_thout/accepted_hits.bam,./C2_R3_thout/accepted_hits.bam
          You are using Cufflinks v2.1.1, which is the most recent release.
          open: No such file or directory
          File ./C1_R1_thout/accepted_hits.bam doesn't appear to be a valid BAM file, trying SAM...
          Error: cannot open alignment file ./C1_R1_thout/accepted_hits.bam for reading

          When I "head" the C1_R1 file, it looks like an unreadable BAM file.

          This seems to be a separate issue. Is it? I can open another thread if it is.

          Thanks,
          Jason

          Comment

          • GenoMax
            Senior Member
            • Feb 2008
            • 7142

            #6
            Are you in the directory where all these (*thout) directories are present when you run the cuffdiff command?

            Comment

            • jmwhitha
              Senior Member
              • Mar 2013
              • 107

              #7
              Yes, I am in the directory which contains the thout directories and those contain the the .bam files.

              Comment

              • GenoMax
                Senior Member
                • Feb 2008
                • 7142

                #8
                Is there a file called "merged.gtf" in the merged_asm directory?

                Can you also use the "code" tags around the actual command line that you are posting so we can see it better? (Click on the "Go advanced" button when you are editing a post. Highlight the command line and then click on the "#" icon in the edit bar at the top).

                Like this:
                Code:
                jmwhitha@jmwhitha-OptiPlex-755:~/my_rnaseq_exp$ cuffdiff -o diff_out -b genome.fa -p 8 -L C1,C2 -u merged_asm/merged.gtf \ ./C1_R1_thout/accepted_hits.bam,./C1_R2_thout/accepted_hits.bam,./C1_R3_thout/accepted_hits.bam \ ./C2_R1_thout/accepted_hits.bam,./C2_R2_thout/accepted_hits.bam,./C2_R3_thout/accepted_hits.bam

                Comment

                • jmwhitha
                  Senior Member
                  • Mar 2013
                  • 107

                  #9
                  Problem solved

                  Thank you so much! PROBLEM SOLVED! Removing the "\" solved the problem.

                  Code:
                  cuffdiff -o diff_out -b genome.fa -p 8 -L C1,C2 -u merged_asm/merged.gtf ./C1_R1_thout/accepted_hits.bam,./C1_R2_thout/accepted_hits.bam,./C1_R3_thout/accepted_hits.bam ./C2_R1_thout/accepted_hits.bam,./C2_R2_thout/accepted_hits.bam,./C2_R3_thout/accepted_hits.bam

                  Comment

                  • jmwhitha
                    Senior Member
                    • Mar 2013
                    • 107

                    #10
                    Really there are two different problems here and two different solutions. Is there someway we can move the second half of this thread to another topic?

                    Comment

                    Latest Articles

                    Collapse

                    • mylaser
                      Reply to Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                      by mylaser
                      Kheloyaar: The Complete Guide to Kheloyaar Loginand Kheloyaar ID
                      The online gaming industry has transformed the way people enjoy digital entertainment. As technology continues to improve, players are looking for platforms that offer convenience, security, and a seamless user experience. Kheloyaarhas gained attention among users who value an easy-to-use platform, quick account access, and a simple registration process.
                      Whether you're exploring Kheloyaar for the first time or want to understand...
                      Yesterday, 09:27 PM
                    • SEQadmin2
                      Advanced Sequencing Platforms Tackle Neuroscience’s Toughest Genomics Problems
                      by SEQadmin2



                      Genomics studies in neuroscience face a special challenge due to the brain’s complexity and scarcity of samples. Mapping changes in cell type and state using conventional next-generation sequencing methods remains challenging. Advances in technologies like single-cell sequencing, spatial transcriptomics, and long-read sequencing have opened the door to deeper studies of the brain and diseases like Alzheimer’s, amyotrophic lateral sclerosis (ALS), and schizophrenia.
                      ...
                      Yesterday, 11:10 AM
                    • SEQadmin2
                      Cancer Drug Resistance: The Lingering Barrier to Rising Survival
                      by SEQadmin2



                      Cancer survival rates have significantly increased in the last few decades in the United States, reaching a combined 70% 5-year survival rate by 2021. Behind this number, there are years of research to find new therapies, drug targets, and early detection methods. But there is one core challenge that keeps slowing down these advances, and it’s about drug resistance.

                      There is no single reason why many patients don’t respond to treatment as expected. Cancer is...
                      07-08-2026, 05:17 AM

                    ad_right_rmr

                    Collapse

                    News

                    Collapse

                    Topics Statistics Last Post
                    Started by SEQadmin2, Yesterday, 10:04 AM
                    0 responses
                    8 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-08-2026, 10:08 AM
                    0 responses
                    7 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-07-2026, 11:05 AM
                    0 responses
                    11 views
                    0 reactions
                    Last Post SEQadmin2  
                    Started by SEQadmin2, 07-02-2026, 11:08 AM
                    0 responses
                    31 views
                    0 reactions
                    Last Post SEQadmin2  
                    Working...