Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • inconsistent CAP3 assembly and alignment

    I have 5 related EST sequences and I want to assemble contigs. I am using the sequence assembly program CAP3. Here is my data:
    Code:
    >ES981358
    GTTACTGTCCAGAGATTCGAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGAATGCACGCGTGGCAGGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCTCCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTGCCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCTTGACCTTTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAAACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTGCAGCTGTGATCTCACTTCGCAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGTTTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAAAGTTATAGGAGATGTTTTCTTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTTAGTCCAA
    >EV115773
    ACTGNGGTCGCCTGCAGGTACCGGTCTCGGATTCCCGGGTCGACCCACGCGTCCGACCGTTGCCGCGCCTCGTTACTCTCTGGCCTCTCTGCAATCATCCATCACCATGTTCATGTTCATCGCTGCAGATTCTGCTCTGAGGTTCACATTGGTAAGGAAGGTCATGGAATAAGGACTTGCATTGGCCCCGGGAGCGGTTCAAGAAGTGCGACTCATGTATGGAAAAGAGGAAGAGCTAGCGACGTCGTATTGTTCCCAAAATGTTTCCACCTCTATGACCGTGCTGTCAAACCGCGAGTTATCCACGACGAGAGGTTCGCCGTCCCTAAGATCTCTGCGGTTCTTGAGCTATGCATACAGGCAGGCGTGGACATCGATAAGTTCCCAGCGAAGCGAAGATCCAAACCTGTTTACAGCATCGAAGGACGGATCGTAGATTTCGAGGAAGTCAACAACGGGAACTCAGAAACCGCAGTTACTAATTCTACTACTACGGCTACACCTTTACAAGAAGATTATCATTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTTTGAAATGGTCACAGGGGTCAAGAAACTGATGGAGAGATACAAAGTGTGGACATGTGGTTACTGTCCAGAGATTCAAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACATAGCTTGCAGAGGTTTTATGGGAAAGCTCCTGCNGTTGTGGAGTTGTGTGTGCAAGGTGGGTGCACCGTGCCTGACCAGTC
    >EV115686
    GGTATATGAAACCTTTGAACAAACTATTGGACTAAAATGGATTCCACAATCTTGTTTTGTTTATATGAAAGGAAGAAAACATCTCCTATAACTTTTTATGAAGTTATATAACATTTTTGCCTTAATGGTACAAAACCTCAACGGGAATGTTGAAATTGCATTAACCTCAAAGCTATTGAGAAGCTGCGAAACTGCGAAGTGAGATCACAGCTGCACGGAGCAGAAGAATCAAACATCTAACTATGTTTCCTAATATGTATATGGAGCTTTCGTTTATTCATATCAATTGTTTCTTGATGCTGAATCACATTGAAAGGTCAAGCGACTAGATCGACTTCATCACGTTGAGGGTAAACCACATCGAGTCTCATCATACTCTTGTACTGGTCAGGCACCGGTGCACCACCTTGCACACACAACTCCACAACCGCAGGAGCTTTCCCATAAAACCTCTGCAAGCTATTGTCAAGAGCAGAAGAATCTGGATCCCGAACATGCCAAACATAGTTTGGACCGACCACGTCGTCAATAGTCGCTTCTTGCCACGCGTGCATTCCGTCTCGCATCTGATGTTTTGTCGCTTTACACATCTTCACTTTGTGTCCCTTTGGACCCACTTGAATCTCTGGACAGTAACCACATGTCCACACTTTGTATCTCTCCATCAGTTTCTTGACCCCTGTGACCATTTCAAACCATGAGTCCATCGTCTCAACGCTTAACTCCTTCAAGCTCTTCTTCTCTGTACTGTAATGA
    >EV005953
    GAACTCAGAAACCGCAGTTACTAGTGTTAGCACGGCTACACCTTTACAAGAAGATGATCATTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTAAGACAATGGATTCATGGTTTGAAATGGTCACAGGGGTCAAGGAACTGATGGAGAAATACAAAGTGTGGACTTGTGGTTACTGTCCAGAGGTTCAAGTGGGTCCCAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAGCATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTGTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCTCCTGCGGTCGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTACCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCGTGACCTTTCAAGGTGATTCAGCATCAAGAAACAATTGATATGAAAAAACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGGTTCTTCTGCTCCGTGCAGCTTCTCACTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGTTTTGTACCA
    >EE435034
    TTATATTGAGGAGATCCCCCGGTGGAGGATGTTAACCGAGATATCTCGGAGAAATATTCGTGCGGGATTTAGCATGATAACGAGGCTCAAAAAATGAAAAGTAGTCTAGCAATTGTAAGCTGAGGACTCTTTCACACAGGAAATAGCTATGATCATGATCATCGCTGGAGATTCTGCTCTGAGGATCACATTGTTTAAGGAAGGTCATGGAATAAGGACTTGCATTGGCCCCGGGAGCGGTTCAAGAAGTGCGACTCATGTATGGAAAAGAGGAAGAGCTAGCGACGTCGTATTGTTCCCAAAATGTTTCCACCTCTATGACCGTGCTGTCAAACCGCGAGTTATCCACGACGAGAGGTTCGCCGTCCCTAAGATCTCTGCGGTTCTTGAGCTATGCATACAGGCAGGCGTGGACATCGATAAGTTCCCAGCGAAGCGAAGATCCAAACCTGTTTACAGCATCGAAGGACGGATCGGTAGATTTCGAGGAAGTCAACAAACGGGAACTCAGAAACCGCAGTTACTAATTCTACTACTACGGCTACACCTTTACAAGAAGATTATCATTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTTTGAAATGTTCACAGGGGTCA


    When I run this through CAP3, I get a contig of EV005953+, EV115686-, and ES981358+, shown below:
    Code:
    EV005953+             GAACTCAGAAACCGCAGTTACTAGTGTTAGCACGGCTACACCTTTACAAGAAGATGATCA
    EV115686-                                                                      TCA
                          ____________________________________________________________
    consensus             GAACTCAGAAACCGCAGTTACTAGTGTTAGCACGGCTACACCTTTACAAGAAGATGATCA
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             TTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTAAGACAATGGATTCATGGTT
    EV115686-             TTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTT
                          ____________________________________________________________
    consensus             TTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTAAGACAATGGACTCATGGTT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             TGAAATGGTCACAGGGGTCAAGGAACTGATGGAGAAATACAAAGTGTGGACTTGTGGTTA
    EV115686-             TGAAATGGTCACAGGGGTCAAGAAACTGATGGAGAGATACAAAGTGTGGACATGTGGTTA
    ES981358+                                                                     GTTA
                          ____________________________________________________________
    consensus             TGAAATGGTCACAGGGGTCAAGAAACTGATGGAGAAATACAAAGTGTGGACATGTGGTTA
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             CTGTCCAGAGGTTCAAGTGGGTCCCAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAA
    EV115686-             CTGTCCAGAGATTCAAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAA
    ES981358+             CTGTCCAGAGATTCGAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAA
                          ____________________________________________________________
    consensus             CTGTCCAGAGATTCAAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAA
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             GCATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGG
    EV115686-             ACATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGG
    ES981358+             ACATCAGATGCGAGACGGAATGCACGCGTGGCAGGAAGCGACTATTGACGACGTGGTCGG
                          ____________________________________________________________
    consensus             ACATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGG
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             TCCAAACTATGTGTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCA
    EV115686-             TCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCA
    ES981358+             TCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCA
                          ____________________________________________________________
    consensus             TCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCA
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             GAGGTTTTATGGGAAAGCTCCTGCGGTCGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGT
    EV115686-             GAGGTTTTATGGGAAAGCTCCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGT
    ES981358+             GAGGTTTTATGGGAAAGCTCCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGT
                          ____________________________________________________________
    consensus             GAGGTTTTATGGGAAAGCTCCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             ACCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGT
    EV115686-             GCCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGT
    ES981358+             GCCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGT
                          ____________________________________________________________
    consensus             GCCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             CGATCTAGTCGCGTGACCTTTCAAGGTGATTCAGCATCAAGAAACAATTGATATGAAAAA
    EV115686-             CGATCTAGTCGCTTGACCTTTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAA
    ES981358+             CGATCTAGTCGCTTGACCTTTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAA
                          ____________________________________________________________
    consensus             CGATCTAGTCGCTTGACCTTTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAA
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             ACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGGTTCTTCTGCTCCGTG
    EV115686-             ACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTG
    ES981358+             ACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTG
                          ____________________________________________________________
    consensus             ACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTG
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             CAGCT                                                       
    EV115686-             CAGCTGTGATCTCACTTCGCAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATT
    ES981358+             CAGCTGTGATCTCACTTCGCAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATT
                          ____________________________________________________________
    consensus             CAGCTGTGATCTCACTTCGCAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115686-             TCAACATTCCCGTTGAGGTTTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAA
    ES981358+             TCAACATTCCCGTTGAGGTTTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAA
                          ____________________________________________________________
    consensus             TCAACATTCCCGTTGAGGTTTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAA
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115686-             AGTTATAGGAGATGTTTTCTTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTT
    ES981358+             AGTTATAGGAGATGTTTTCTTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTT
                          ____________________________________________________________
    consensus             AGTTATAGGAGATGTTTTCTTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115686-             AGTCCAATAGTTTGTTCAAAGGTTTCATATACC
    ES981358+             AGTCCAA                          
                          ____________________________________________________________
    consensus             AGTCCAATAGTTTGTTCAAAGGTTTCATATACC
    However, I saw somewhere else that actually EV115773 should also align with the other sequences. To test this I gave just the relevant 4 sequences as the input:
    Code:
    >ES981358
    GTTACTGTCCAGAGATTCGAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGAATGCACGCGTGGCAGGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCTCCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTGCCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCTTGACCTTTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAAACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTGCAGCTGTGATCTCACTTCGCAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGTTTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAAAGTTATAGGAGATGTTTTCTTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTTAGTCCAA
    >EV115773
    ACTGNGGTCGCCTGCAGGTACCGGTCTCGGATTCCCGGGTCGACCCACGCGTCCGACCGTTGCCGCGCCTCGTTACTCTCTGGCCTCTCTGCAATCATCCATCACCATGTTCATGTTCATCGCTGCAGATTCTGCTCTGAGGTTCACATTGGTAAGGAAGGTCATGGAATAAGGACTTGCATTGGCCCCGGGAGCGGTTCAAGAAGTGCGACTCATGTATGGAAAAGAGGAAGAGCTAGCGACGTCGTATTGTTCCCAAAATGTTTCCACCTCTATGACCGTGCTGTCAAACCGCGAGTTATCCACGACGAGAGGTTCGCCGTCCCTAAGATCTCTGCGGTTCTTGAGCTATGCATACAGGCAGGCGTGGACATCGATAAGTTCCCAGCGAAGCGAAGATCCAAACCTGTTTACAGCATCGAAGGACGGATCGTAGATTTCGAGGAAGTCAACAACGGGAACTCAGAAACCGCAGTTACTAATTCTACTACTACGGCTACACCTTTACAAGAAGATTATCATTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTTTGAAATGGTCACAGGGGTCAAGAAACTGATGGAGAGATACAAAGTGTGGACATGTGGTTACTGTCCAGAGATTCAAGTGGGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACATAGCTTGCAGAGGTTTTATGGGAAAGCTCCTGCNGTTGTGGAGTTGTGTGTGCAAGGTGGGTGCACCGTGCCTGACCAGTC
    >EV115686
    GGTATATGAAACCTTTGAACAAACTATTGGACTAAAATGGATTCCACAATCTTGTTTTGTTTATATGAAAGGAAGAAAACATCTCCTATAACTTTTTATGAAGTTATATAACATTTTTGCCTTAATGGTACAAAACCTCAACGGGAATGTTGAAATTGCATTAACCTCAAAGCTATTGAGAAGCTGCGAAACTGCGAAGTGAGATCACAGCTGCACGGAGCAGAAGAATCAAACATCTAACTATGTTTCCTAATATGTATATGGAGCTTTCGTTTATTCATATCAATTGTTTCTTGATGCTGAATCACATTGAAAGGTCAAGCGACTAGATCGACTTCATCACGTTGAGGGTAAACCACATCGAGTCTCATCATACTCTTGTACTGGTCAGGCACCGGTGCACCACCTTGCACACACAACTCCACAACCGCAGGAGCTTTCCCATAAAACCTCTGCAAGCTATTGTCAAGAGCAGAAGAATCTGGATCCCGAACATGCCAAACATAGTTTGGACCGACCACGTCGTCAATAGTCGCTTCTTGCCACGCGTGCATTCCGTCTCGCATCTGATGTTTTGTCGCTTTACACATCTTCACTTTGTGTCCCTTTGGACCCACTTGAATCTCTGGACAGTAACCACATGTCCACACTTTGTATCTCTCCATCAGTTTCTTGACCCCTGTGACCATTTCAAACCATGAGTCCATCGTCTCAACGCTTAACTCCTTCAAGCTCTTCTTCTCTGTACTGTAATGA
    >EV005953
    GAACTCAGAAACCGCAGTTACTAGTGTTAGCACGGCTACACCTTTACAAGAAGATGATCATTACAGTACAGAGAAGAAGAGCTTGAAGGAGTTAAGCGTTAAGACAATGGATTCATGGTTTGAAATGGTCACAGGGGTCAAGGAACTGATGGAGAAATACAAAGTGTGGACTTGTGGTTACTGTCCAGAGGTTCAAGTGGGTCCCAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAGCATCAGATGCGAGACGGAATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTGTGGCATGTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCTCCTGCGGTCGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTACCTGACCAGTACAAGAGTATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCGTGACCTTTCAAGGTGATTCAGCATCAAGAAACAATTGATATGAAAAAACGAAAGCTCCATATACATATTAGGAAACATAGTTAGATGTTTGGTTCTTCTGCTCCGTGCAGCTTCTCACTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGTTTTGTACCA


    Now, I get an alignment where all the 4 sequences align:
    Code:
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             ACTGNGGTCGCCTGCAGGTACCGGTCTCGGATTCCCGGGTCGACCCACGCGTCCGACCGT
                          ____________________________________________________________
    consensus             ACTGNGGTCGCCTGCAGGTACCGGTCTCGGATTCCCGGGTCGACCCACGCGTCCGACCGT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             TGCCGCGCCTCGTTACTCTCTGGCCTCTCTGCAATCATCCATCACCATGTTCATGTTCAT
                          ____________________________________________________________
    consensus             TGCCGCGCCTCGTTACTCTCTGGCCTCTCTGCAATCATCCATCACCATGTTCATGTTCAT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             CGCTGCAGATTCTGCTCTGAGGTTCACATTGGTAAGGAAGGTCATGGAATAAGGACTTGC
                          ____________________________________________________________
    consensus             CGCTGCAGATTCTGCTCTGAGGTTCACATTGGTAAGGAAGGTCATGGAATAAGGACTTGC
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             ATTGGCCCCGGGAGCGGTTCAAGAAGTGCGACTCATGTATGGAAAAGAGGAAGAGCTAGC
                          ____________________________________________________________
    consensus             ATTGGCCCCGGGAGCGGTTCAAGAAGTGCGACTCATGTATGGAAAAGAGGAAGAGCTAGC
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             GACGTCGTATTGTTCCCAAAATGTTTCCACCTCTATGACCGTGCTGTCAAACCGCGAGTT
                          ____________________________________________________________
    consensus             GACGTCGTATTGTTCCCAAAATGTTTCCACCTCTATGACCGTGCTGTCAAACCGCGAGTT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             ATCCACGACGAGAGGTTCGCCGTCCCTAAGATCTCTGCGGTTCTTGAGCTATGCATACAG
                          ____________________________________________________________
    consensus             ATCCACGACGAGAGGTTCGCCGTCCCTAAGATCTCTGCGGTTCTTGAGCTATGCATACAG
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             GCAGGCGTGGACATCGATAAGTTCCCAGCGAAGCGAAGATCCAAACCTGTTTACAGCATC
                          ____________________________________________________________
    consensus             GCAGGCGTGGACATCGATAAGTTCCCAGCGAAGCGAAGATCCAAACCTGTTTACAGCATC
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             GAAGGACGGATCGTAGATTTCGAGGAAGTCAACAACGGGAACTCAGAAACCGCAGTTACT
                          ____________________________________________________________
    consensus             GAAGGACGGATCGTAGATTTCGAGGAAGTCAACAACGGGAACTCAGAAACCGCAGTTACT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             AATTCTACTACTACGGCTACACCTTTACAAGAAGATTATCATTACAGTACAGAGAAGAAG
    EV005953+                         ACGGCTACACCTTTACAAGAAGATGATCATTACAGTACAGAGAAGAAG
    EV115686-                                                   TCATTACAGTACAGAGAAGAAG
                          ____________________________________________________________
    consensus             AATTCTACTACTACGGCTACACCTTTACAAGAAGATGATCATTACAGTACAGAGAAGAAG
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             AGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTTTGAAATGGTCACAGGGGTC
    EV005953+             AGCTTGAAGGAGTTAAGCGTTAAGACAATGGATTCATGGTTTGAAATGGTCACAGGGGTC
    EV115686-             AGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTTTGAAATGGTCACAGGGGTC
                          ____________________________________________________________
    consensus             AGCTTGAAGGAGTTAAGCGTTGAGACGATGGACTCATGGTTTGAAATGGTCACAGGGGTC
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             AAGAAACTGATGGAGAGATACAAAGTGTGGACATGTGGTTACTGTCCAGAGATTCAAGTG
    EV005953+             AAGGAACTGATGGAGAAATACAAAGTGTGGACTTGTGGTTACTGTCCAGAGGTTCAAGTG
    EV115686-             AAGAAACTGATGGAGAGATACAAAGTGTGGACATGTGGTTACTGTCCAGAGATTCAAGTG
    ES981358+                                                  GTTACTGTCCAGAGATTCGAGTG
                          ____________________________________________________________
    consensus             AAGAAACTGATGGAGAGATACAAAGTGTGGACATGTGGTTACTGTCCAGAGATTCAAGTG
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             GGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGA
    EV005953+             GGTCCCAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAGCATCAGATGCGAGACGGA
    EV115686-             GGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGA
    ES981358+             GGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGA
                          ____________________________________________________________
    consensus             GGTCCAAAGGGACACAAAGTGAAGATGTGTAAAGCGACAAAACATCAGATGCGAGACGGA
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             ATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCAT
    EV005953+             ATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTGTGGCAT
    EV115686-             ATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCAT
    ES981358+             ATGCACGCGTGGCAGGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCAT
                          ____________________________________________________________
    consensus             ATGCACGCGTGGCAAGAAGCGACTATTGACGACGTGGTCGGTCCAAACTATGTTTGGCAT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             GTTCGGGATCCAGATTCTTCTGCTCTTGACA-TAGCTTGCAGAGGTTTTATGGGAAAGCT
    EV005953+             GTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCT
    EV115686-             GTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCT
    ES981358+             GTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCT
                          ____________________________________________________________
    consensus             GTTCGGGATCCAGATTCTTCTGCTCTTGACAATAGCTTGCAGAGGTTTTATGGGAAAGCT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115773+             CCTGCNGTTGTGGAGTTGTGTGTGCAAGGTGG                            
    EV005953+             CCTGCGGTCGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTACCTGACCAGTACAAGAGT
    EV115686-             CCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTGCCTGACCAGTACAAGAGT
    ES981358+             CCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTGCCTGACCAGTACAAGAGT
                          ____________________________________________________________
    consensus             CCTGCGGTTGTGGAGTTGTGTGTGCAAGGTGGTGCACCGGTGCCTGACCAGTACAAGAGT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             ATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCGTGACCT
    EV115686-             ATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCTTGACCT
    ES981358+             ATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCTTGACCT
                          ____________________________________________________________
    consensus             ATGATGAGACTCGATGTGGTTTACCCTCAACGTGATGAAGTCGATCTAGTCGCTTGACCT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             TTCAAGGTGATTCAGCATCAAGAAACAATTGATATGAAAAAACGAAAGCTCCATATACAT
    EV115686-             TTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAAACGAAAGCTCCATATACAT
    ES981358+             TTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAAACGAAAGCTCCATATACAT
                          ____________________________________________________________
    consensus             TTCAATGTGATTCAGCATCAAGAAACAATTGATATGAATAAACGAAAGCTCCATATACAT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV005953+             ATTAGGAAACATAGTTAGATGTTTGGTTCTTCTGCTCCGTGCAGCT              
    EV115686-             ATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTGCAGCTGTGATCTCACTTCG
    ES981358+             ATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTGCAGCTGTGATCTCACTTCG
                          ____________________________________________________________
    consensus             ATTAGGAAACATAGTTAGATGTTTGATTCTTCTGCTCCGTGCAGCTGTGATCTCACTTCG
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115686-             CAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGT
    ES981358+             CAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGT
                          ____________________________________________________________
    consensus             CAGTTTCGCAGCTTCTCAATAGCTTTGAGGTTAATGCAATTTCAACATTCCCGTTGAGGT
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115686-             TTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAAAGTTATAGGAGATGTTTTC
    ES981358+             TTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAAAGTTATAGGAGATGTTTTC
                          ____________________________________________________________
    consensus             TTTGTACCATTAAGGCAAAAATGTTATATAACTTCATAAAAAGTTATAGGAGATGTTTTC
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115686-             TTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTTAGTCCAATAGTTTGTTCAA
    ES981358+             TTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTTAGTCCAA            
                          ____________________________________________________________
    consensus             TTCCTTTCATATAAACAAAACAAGATTGTGGAATCCATTTTAGTCCAATAGTTTGTTCAA
    
                              .    :    .    :    .    :    .    :    .    :    .    :
    EV115686-             AGGTTTCATATACC
                          ____________________________________________________________
    consensus             AGGTTTCATATACC


    This seems to be correct. So why did the first run not align EV115773 ut gave it as a singlet? How can we correctly run CAP3 to give consistent results? All of this can be checked using the online CAP3 page at http://pbil.univ-lyon1.fr/cap3.php or by downloading CAP3 from http://seq.cs.iastate.edu/cap3.html

Latest Articles

Collapse

  • seqadmin
    Latest Developments in Precision Medicine
    by seqadmin



    Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

    Somatic Genomics
    “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
    Yesterday, 01:16 PM
  • seqadmin
    Recent Advances in Sequencing Analysis Tools
    by seqadmin


    The sequencing world is rapidly changing due to declining costs, enhanced accuracies, and the advent of newer, cutting-edge instruments. Equally important to these developments are improvements in sequencing analysis, a process that converts vast amounts of raw data into a comprehensible and meaningful form. This complex task requires expertise and the right analysis tools. In this article, we highlight the progress and innovation in sequencing analysis by reviewing several of the...
    05-06-2024, 07:48 AM

ad_right_rmr

Collapse

News

Collapse

Topics Statistics Last Post
Started by seqadmin, Yesterday, 07:15 AM
0 responses
13 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 10:28 AM
0 responses
17 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-23-2024, 07:35 AM
0 responses
20 views
0 likes
Last Post seqadmin  
Started by seqadmin, 05-22-2024, 02:06 PM
0 responses
10 views
0 likes
Last Post seqadmin  
Working...
X