Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • problem running multiz with MAF files

    i downloaded some pairwise alignment files from UCSC in the axtnet format and converted these to the MAF format the general header looks like this

    a score=21045.000000
    s chr10 1454 357 + 94855758 aataaaaattattggtccccattcctagtgattccaa
    s chr14 106421274 333 - 108792865 aataaaaattctttggccccattcttagtgagtcc

    I had run multiz using these files and then while running phastcons i found out that organisms had not been specified therefore i converted these headers to the appropriate format

    a score=21045.000000
    s organism1.chr10 1454 357 + 94855758 aataaaaattattggtccccattcctag
    s organism2.chr14 106421274 333 - 108792865 aataaaaattctttggccccattctta

    and when i run these files i get an error line 11 of organism1.organism2.maf : inconsistent row size

    and this problem is common in all files where i have made this change
    it would be really helpful if someone can point out the problem here.

    the multiz command i use is

    multiz chr1.organism1.organism2.maf chr1.organism1.organism3.maf chr1.unused > chr1.organism1.organism2.organism3.maf


    and the command i used to change them was:

    awk '/a score/{print;getline;gsub(/chr/,"organism1.chr",$0);print;getline;gsub(/chr/,"organism2.chr",$0);print} /#/{print;}' chr1.organism1.organism2.maf > chr1.organism1.organism2.maf2

  • #2
    bump

    not to spam or anything but i really need help on this. so bump!

    Comment


    • #3
      Hi koustavpal,

      Were you able to figure it out? What was causing the problem? what Phastcons command did you use? I am in the same situation. Please let me know.


      thank you,

      -Milo

      Originally posted by koustavpal View Post
      i downloaded some pairwise alignment files from UCSC in the axtnet format and converted these to the MAF format the general header looks like this

      a score=21045.000000
      s chr10 1454 357 + 94855758 aataaaaattattggtccccattcctagtgattccaa
      s chr14 106421274 333 - 108792865 aataaaaattctttggccccattcttagtgagtcc

      I had run multiz using these files and then while running phastcons i found out that organisms had not been specified therefore i converted these headers to the appropriate format

      a score=21045.000000
      s organism1.chr10 1454 357 + 94855758 aataaaaattattggtccccattcctag
      s organism2.chr14 106421274 333 - 108792865 aataaaaattctttggccccattctta

      and when i run these files i get an error line 11 of organism1.organism2.maf : inconsistent row size

      and this problem is common in all files where i have made this change
      it would be really helpful if someone can point out the problem here.

      the multiz command i use is

      multiz chr1.organism1.organism2.maf chr1.organism1.organism3.maf chr1.unused > chr1.organism1.organism2.organism3.maf


      and the command i used to change them was:

      awk '/a score/{print;getline;gsub(/chr/,"organism1.chr",$0);print;getline;gsub(/chr/,"organism2.chr",$0);print} /#/{print;}' chr1.organism1.organism2.maf > chr1.organism1.organism2.maf2

      Comment


      • #4
        Hi milo,

        I figured out the problem and got the entire pipeline working a long time ago, so it's a bit hard for me to remember how i did it. I'll try to help out as much as I can. So basically the first and only document I extensively referred to solve it was the UCSC 28way vertebrate alignment track documentation here http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2099589/

        Maybe you can start there if you haven't already.

        On a side note, this particular pipeline is a long and tedious one, so unless you are trying to do something which hasn't already been done I would strongly recommend against going forward with this. Maybe if you told me what you are trying to accomplish I can help you out with that.

        Comment


        • #5
          Hi koustavpal,

          Thank you for the quick reply. I am currently aligning two de novo plant genomes (wild and domesticated genomes) and I am using a related plant genome as reference. My goal is to analyse the genetic diversity and differentiation within and between the domesticated and wild plant. I have already completed the alignment using LASTZ and combined the MAF alignments using MULTIZ but I am confused on what would be my next step. What would you recommend? Should I continue with the LASTZ pipeline or do you have a better method in mind? I would really appreciate your help.


          Regards,

          -Milo

          Originally posted by koustavpal View Post
          Hi milo,

          I figured out the problem and got the entire pipeline working a long time ago, so it's a bit hard for me to remember how i did it. I'll try to help out as much as I can. So basically the first and only document I extensively referred to solve it was the UCSC 28way vertebrate alignment track documentation here http://www.ncbi.nlm.nih.gov/pmc/articles/PMC2099589/

          Maybe you can start there if you haven't already.

          On a side note, this particular pipeline is a long and tedious one, so unless you are trying to do something which hasn't already been done I would strongly recommend against going forward with this. Maybe if you told me what you are trying to accomplish I can help you out with that.

          Comment

          Latest Articles

          Collapse

          • seqadmin
            Essential Discoveries and Tools in Epitranscriptomics
            by seqadmin




            The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
            04-22-2024, 07:01 AM
          • seqadmin
            Current Approaches to Protein Sequencing
            by seqadmin


            Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
            04-04-2024, 04:25 PM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by seqadmin, 04-25-2024, 11:49 AM
          0 responses
          19 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-24-2024, 08:47 AM
          0 responses
          20 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-11-2024, 12:08 PM
          0 responses
          62 views
          0 likes
          Last Post seqadmin  
          Started by seqadmin, 04-10-2024, 10:19 PM
          0 responses
          61 views
          0 likes
          Last Post seqadmin  
          Working...
          X