Dear FOlks,
I am so new, an early stage researcher.
I am using TopHat2 to map the reads, I guess, I am fulfilling all the requirements, my code is
/usr/local/bin/tophat2 -p 8 -G ~/path/to/Homo_sapiens.GRCh37.72.gtf -o
~/path/to/Human_mapping_iPS_s7_rep1
--splice-mismatches 1 --max-multihits 30 --microexon-search --fusion-search
~/path/to/bowtie2_index/hg19
~/path/to/myfile.fastq
I am submitting on grid engine cluster with qsub -l h_vmem=50G [above_script]
this is showing error as:
"""""TopHat requires all reads be either FASTQ or FASTA. Mixing formats is not supported"""
I am bit frustrated because my fastq files look fine to me as shown in code
@SOLEXA-GA05_00009_SRi_AD_MS_BN_VW:7:1:2364:933#ATGAGCA
NGGCCTTCCCACATTCTTTACACTCATAGGTTTTCTCACCAGTGTGAGTTCTCTTGTGCACAATAAGGTAAGAGCC
+SOLEXA-GA05_00009_SRi_AD_MS_BN_VW:7:1:2364:933#ATGAGCA
!454478347;09977778<655476;69;8588380745<75;57495945158::=677976:7674:64763-
Please help???????
I am so new, an early stage researcher.
I am using TopHat2 to map the reads, I guess, I am fulfilling all the requirements, my code is
/usr/local/bin/tophat2 -p 8 -G ~/path/to/Homo_sapiens.GRCh37.72.gtf -o
~/path/to/Human_mapping_iPS_s7_rep1
--splice-mismatches 1 --max-multihits 30 --microexon-search --fusion-search
~/path/to/bowtie2_index/hg19
~/path/to/myfile.fastq
I am submitting on grid engine cluster with qsub -l h_vmem=50G [above_script]
this is showing error as:
"""""TopHat requires all reads be either FASTQ or FASTA. Mixing formats is not supported"""
I am bit frustrated because my fastq files look fine to me as shown in code
@SOLEXA-GA05_00009_SRi_AD_MS_BN_VW:7:1:2364:933#ATGAGCA
NGGCCTTCCCACATTCTTTACACTCATAGGTTTTCTCACCAGTGTGAGTTCTCTTGTGCACAATAAGGTAAGAGCC
+SOLEXA-GA05_00009_SRi_AD_MS_BN_VW:7:1:2364:933#ATGAGCA
!454478347;09977778<655476;69;8588380745<75;57495945158::=677976:7674:64763-
Please help???????

Comment