Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Trim Galore output issue

    I have both RRBS and RNAseq datasets that I'm trying to filter for quality and trim adaptors using Trim Galore. When I run it on the RRBS fq files using the --RRBS option, the resulting fq output looks fine:

    @HWI-ST330:336274FACXX:3:1101:13152:1997 1:N:0:CTTGTA
    NGGGTTGTTTTATGGAGAGCGGAGGGT
    +
    #4=DDDFDHHHHHJJIJIIGJJIIJJ?
    @HWI-ST330:336274FACXX:3:1101:14593:1999 1:N:0:CTTGTA
    NGGTAATTCGTTTTTTATAAGGCGAAT
    +
    #1=DFFFFHHHHHJJJJJJJHGIJJJJ
    @HWI-ST330:336274FACXX:3:1101:18911:1998 1:N:0:CTTGTA
    NGGGGTTTAGACGTAGTAGGTGTTTT
    +
    #1=DFDDFHHHHHGHJGHIJAFFHIJ

    But when I run it on the RNAseq samples without the --RRBS option, there are additional spaces in the fastq output:

    @DBRHHJN1:326:C233EACXX:1:1101:1305:1193 1:N:0:ATCACG
    CTTTNTGTGGCTCAGGATGGAGGTGGCCACATTGGCCAGCAACTCAGCCAGGCCGGGGCCTTCCTTCCCAGCAATTCGAGGCGCGGCCAGCGCCTGCCGC

    +
    ???D#2=ADDDDDIIIIEFIEEF+CEDE>DDEIIEDBED=DDCEBDD@CDDDCDDIAD>@?AAAAAAA?AA=??AAA?E?>5;>;>95;8<;;>>???>>

    @DBRHHJN1:326:C233EACXX:1:1101:1287:1222 1:N:0:ATCACG
    CTTGNAAATGGCGTCAAAGGTGGCCTTGGCGAAGTTGCCCAGGGTGGCAGTGCAGCCCCTGGCAGAGGTGTAGCAGTCATCAATTCCTGCCATCATCAGC

    +
    ?@@D#2=AFHH?FH<ECFHHHGGEEGEGH@D@)?DHI9?BCFGIHII=@?7A;7?>BB?ACCA=?(98,<C:C:5,53:@>>4:@::@@CB>@93>>:::

    @DBRHHJN1:326:C233EACXX:1:1101:1252:1244 1:N:0:ATCACG

    I've tried running it a few different ways, and discovered that I only get the output with added spaces when I don't use the --RRBS option. My question is how do I fix this issue? I don't want to use the --RRBS option with the RNAseq data, as it will remove an additional 2bp from the trimmed reads. Is there a way to prevent Trim Galore from adding these spaces? Or is there a way for me to remove the spaces from the output files? Thanks!

  • #2
    The simplest way might be to use awk? (but will be slow)

    awk '{if(length($0)>=1)print $0}' input.fq
    something like that, I haven't tested the code though...

    Comment


    • #3
      This was a bug that had been introduced accidentally... If you get the latest version of Trim Galore it should be fine, sorry for the inconvenience caused. This is from the latest release notes:

      Code:
      10-09-13: Version 0.3.3 released
      
          Fixed a bug what was accidentally introduced which would add an additional empty line in single-end trimming mode

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Current Approaches to Protein Sequencing
        by seqadmin


        Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
        04-04-2024, 04:25 PM
      • seqadmin
        Strategies for Sequencing Challenging Samples
        by seqadmin


        Despite advancements in sequencing platforms and related sample preparation technologies, certain sample types continue to present significant challenges that can compromise sequencing results. Pedro Echave, Senior Manager of the Global Business Segment at Revvity, explained that the success of a sequencing experiment ultimately depends on the amount and integrity of the nucleic acid template (RNA or DNA) obtained from a sample. “The better the quality of the nucleic acid isolated...
        03-22-2024, 06:39 AM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 04-11-2024, 12:08 PM
      0 responses
      18 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 10:19 PM
      0 responses
      22 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-10-2024, 09:21 AM
      0 responses
      17 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 04-04-2024, 09:00 AM
      0 responses
      49 views
      0 likes
      Last Post seqadmin  
      Working...
      X