Header Leaderboard Ad

Collapse

Trim Galore output issue

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Trim Galore output issue

    I have both RRBS and RNAseq datasets that I'm trying to filter for quality and trim adaptors using Trim Galore. When I run it on the RRBS fq files using the --RRBS option, the resulting fq output looks fine:

    @HWI-ST330:336274FACXX:3:1101:13152:1997 1:N:0:CTTGTA
    NGGGTTGTTTTATGGAGAGCGGAGGGT
    +
    #4=DDDFDHHHHHJJIJIIGJJIIJJ?
    @HWI-ST330:336274FACXX:3:1101:14593:1999 1:N:0:CTTGTA
    NGGTAATTCGTTTTTTATAAGGCGAAT
    +
    #1=DFFFFHHHHHJJJJJJJHGIJJJJ
    @HWI-ST330:336274FACXX:3:1101:18911:1998 1:N:0:CTTGTA
    NGGGGTTTAGACGTAGTAGGTGTTTT
    +
    #1=DFDDFHHHHHGHJGHIJAFFHIJ

    But when I run it on the RNAseq samples without the --RRBS option, there are additional spaces in the fastq output:

    @DBRHHJN1:326:C233EACXX:1:1101:1305:1193 1:N:0:ATCACG
    CTTTNTGTGGCTCAGGATGGAGGTGGCCACATTGGCCAGCAACTCAGCCAGGCCGGGGCCTTCCTTCCCAGCAATTCGAGGCGCGGCCAGCGCCTGCCGC

    +
    ???D#2=ADDDDDIIIIEFIEEF+CEDE>[email protected]>@?AAAAAAA?AA=??AAA?E?>5;>;>95;8<;;>>???>>

    @DBRHHJN1:326:C233EACXX:1:1101:1287:1222 1:N:0:ATCACG
    CTTGNAAATGGCGTCAAAGGTGGCCTTGGCGAAGTTGCCCAGGGTGGCAGTGCAGCCCCTGGCAGAGGTGTAGCAGTCATCAATTCCTGCCATCATCAGC

    +
    [email protected]@D#2=AFHH?FH<[email protected]@)[email protected]?7A;7?>BB?ACCA=?(98,<C:C:5,53:@>>4:@::@@CB>@93>>:::

    @DBRHHJN1:326:C233EACXX:1:1101:1252:1244 1:N:0:ATCACG

    I've tried running it a few different ways, and discovered that I only get the output with added spaces when I don't use the --RRBS option. My question is how do I fix this issue? I don't want to use the --RRBS option with the RNAseq data, as it will remove an additional 2bp from the trimmed reads. Is there a way to prevent Trim Galore from adding these spaces? Or is there a way for me to remove the spaces from the output files? Thanks!

  • #2
    The simplest way might be to use awk? (but will be slow)

    awk '{if(length($0)>=1)print $0}' input.fq
    something like that, I haven't tested the code though...

    Comment


    • #3
      This was a bug that had been introduced accidentally... If you get the latest version of Trim Galore it should be fine, sorry for the inconvenience caused. This is from the latest release notes:

      Code:
      10-09-13: Version 0.3.3 released
      
          Fixed a bug what was accidentally introduced which would add an additional empty line in single-end trimming mode

      Comment

      Latest Articles

      Collapse

      • seqadmin
        Targeted Sequencing: Choosing Between Hybridization Capture and Amplicon Sequencing
        by seqadmin




        Targeted sequencing is an effective way to sequence and analyze specific genomic regions of interest. This method enables researchers to focus their efforts on their desired targets, as opposed to other methods like whole genome sequencing that involve the sequencing of total DNA. Utilizing targeted sequencing is an attractive option for many researchers because it is often faster, more cost-effective, and only generates applicable data. While there are many approaches...
        03-10-2023, 05:31 AM
      • seqadmin
        Expert Advice on Automating Your Library Preparations
        by seqadmin



        Using automation to prepare sequencing libraries isn’t a new concept, and most researchers are aware that there are numerous benefits to automating this process. However, many labs are still hesitant to switch to automation and often believe that it’s not suitable for their lab. To combat these concerns, we’ll cover some of the key advantages, review the most important considerations, and get real-world advice from automation experts to remove any lingering anxieties....
        02-21-2023, 02:14 PM

      ad_right_rmr

      Collapse

      News

      Collapse

      Topics Statistics Last Post
      Started by seqadmin, 03-17-2023, 12:32 PM
      0 responses
      8 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 03-15-2023, 12:42 PM
      0 responses
      17 views
      0 likes
      Last Post seqadmin  
      Started by seqadmin, 03-09-2023, 10:17 AM
      0 responses
      66 views
      1 like
      Last Post seqadmin  
      Started by seqadmin, 03-03-2023, 12:03 PM
      0 responses
      64 views
      0 likes
      Last Post seqadmin  
      Working...
      X