Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • Problems with blastdbcmd with entry ID contains space

    I am a rookie still in this area, this is the first thing I was requested to do: to extract a list of 100% matched reads from a self-generated database. However, the reads' names are not formatted in the regular way. I assume that's what I am encountering now.

    Below is a a list of my reads' names:
    this is part of my entry_batch input file -- ID.txt

    'M00344:4:000000000-A5RU9:1:2119:17016:21751 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2119:6591:19854 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2119:11445:14212 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2119:22676:7504 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2119:13009:4084 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2119:14454:4004 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2118:11021:19828 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2118:14025:16724 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2118:25864:15172 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2118:13018:13673 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2118:5760:11441 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2117:24461:19844 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2117:17300:18233 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2117:4137:17412 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2117:2789:15268 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2117:25164:15029 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2117:16039:7681 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2117:8713:5016 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2116:13795:20195 2:N:0:10'
    'M00344:4:000000000-A5RU9:1:2116:6977:17108 2:N:0:10'

    I used commands below:
    $ blastdbcmd -db seqs.fasta -dbtype nucl -entry_batch ID.txt -out miseq.read.fasta

    Error messages:

    Error: 'M00344:4:000000000-A5RU9:1:1104:13049:19775: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:13044:19758: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:13062:19751: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:11099:18531: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:11118:18521: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:17175:17791: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:17452:17720: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:16737:13751: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:16726:13733: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:19339:9296: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:17187:8943: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:14936:7801: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:21379:6845: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:23493:5643: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:26299:4746: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:23691:4053: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1104:15699:3766: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1103:18377:16637: OID not found
    Error: 'M00344:4:000000000-A5RU9:1:1103:16030:10176: OID not found


    I tried changing white space to \s, or add ' before and after each id names, but it didn't help at all. The blastdbcmd program recognizes anything before the space as the id names. Anyone has any idea how to do it? Or I am totally heading in the wrong direction?

    Eddi

  • #2
    Here's what I run to generate a BLAST database out of a FASTA file:
    Code:
    makeblastdb -in <input>.fasta -title 'Something Stringy' -taxid <org_taxid> -dbtype nucl -out <dbname_ID>
    It looks like you might be trying to query a database that doesn't exist (or hasn't been generated yet).

    However, if you have an NGS-amount of reads, it's probably better to use something other than BLAST for sequence matching. I'd recommend Bowtie2, but BWA seems to also be commonly used here.

    Here's the command I'd run to generate a Bowtie2 index:
    Code:
    bowtie2-build <input>.fasta <dbname_ID>

    Comment


    • #3
      Originally posted by yingeddi2008 View Post
      I tried changing white space to \s, or add ' before and after each id names, but it didn't help at all. The blastdbcmd program recognizes anything before the space as the id names. Anyone has any idea how to do it? Or I am totally heading in the wrong direction?
      Hi Eddi. This is by partly design - most tools consider everything up to the first space as the ID.

      However there are also some issues with the blastdbcmd, and the exact version of BLAST+ is important, see my blog post:
      The blastdbcmd tool in the BLAST+ suite (replacing fastacmd in the C 'legacy' BLAST suite) lets you do a lot of clever things with a BLAST d...

      Comment


      • #4
        blastdbcmd sucks

        Hi maubp,

        Thank you very much. I read through your blog. I think that's exactly what I have problem now. Then there is no way I can extract sequences from my own custom database?!

        For example, in my database, I have

        Code:
        >M00344:4:000000000-A5RU9:1:1101:17539:1069 1:N:0:14
        AAGAGTTTGATCATGGCTCAGGACGAACGCTGGCGGCGTGCCTAACACATGCAAGTCGAGCGATGAAACCCTTCGGGGTGGATTAGCGGCGGACGGGTGAGTAACACGTGGGCAACCTGCCTCAAAGAGGGGGATAGCCTCCCGAAAGGGAGATTAATACCGCATAATAAGTACTTCTCGCATGGGAAGAACTTTAAAGGAGCAATCCGCTTTGAGATGGGCCCGCGGCGCATTAGCTAGTTGGTGAGGTAAAGGCTCACAAAGGCGACGATGCGTAGCCGACCTGAGAGGGTGATCGGCG
        >M00344:4:000000000-A5RU9:1:1101:17556:1074 1:N:0:14
        AAGAGTTTGATCATGGCTCAGGACGAACGCTGGCGGCGTGCCTAACACATGCAAGTCGAGCGATGAAACCCTTCGGGGTGGATTAGCGGCGGACGGGTGAGTAACACGTGGGCAACCTGCCTCAAAGAGGGGGATAGCCTCCCGAAAGGGAGATTAATACCGCATAATAAGTACTTCTCGCATGGGAAGAACTTTAAAGGAGCAATCCGCTTTGAGATGGGCCCGCGGCGCATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGACGATGCGTAGCCGAACTGAGAGGGGGATCGGC
        But when I run

        Code:
        $ blastdbcmd -db seq.fasta -entry all -outfmt "OID: %o     TITLE: %t"
        I got nothing back, I don't know whether there is an internal error or it won't recognize any IDs that are not in NCBI format. That is so unfortunate.


        Eddi

        Originally posted by maubp View Post
        Hi Eddi. This is by partly design - most tools consider everything up to the first space as the ID.

        However there are also some issues with the blastdbcmd, and the exact version of BLAST+ is important, see my blog post:
        http://blastedbio.blogspot.co.uk/201...cbi-blast.html

        Comment


        • #5
          Hi gringer,

          Thank you for your advice, I will try Bowtie2 or BWA. I have Illumina Miseq data here. Maybe I should try something else.

          Eddi

          Comment


          • #6
            Originally posted by yingeddi2008 View Post
            Thank you very much. I read through your blog. I think that's exactly what I have problem now.
            Please email them to check (and make sure they know people are having problems with blastdbcmd to help prioritise fixing this). Thanks!
            Originally posted by yingeddi2008 View Post
            Then there is no way I can extract sequences from my own custom database?!
            As long as you still have the FASTA file you made the BLAST database from, you can extract the records from the FASTA file. There are several tools for this (including support in scripting libraries like Biopython, BioPerl, BioRuby etc).

            Comment


            • #7
              Thank you.

              Hi maubp,

              Originally posted by maubp View Post
              Please email them to check (and make sure they know people are having problems with blastdbcmd to help prioritise fixing this). Thanks!
              Who should I email to? These NCBI guys?

              Originally posted by maubp View Post
              As long as you still have the FASTA file you made the BLAST database from, you can extract the records from the FASTA file. There are several tools for this (including support in scripting libraries like Biopython, BioPerl, BioRuby etc).
              I will try those then. Thank you.

              Eddi

              Comment


              • #8
                Originally posted by maubp View Post
                Please email them to check (and make sure they know people are having problems with blastdbcmd to help prioritise fixing this). Thanks!
                blast-help at ncbi.nlm.nih.gov as listed here:

                Comment

                Latest Articles

                Collapse

                • seqadmin
                  Essential Discoveries and Tools in Epitranscriptomics
                  by seqadmin




                  The field of epigenetics has traditionally concentrated more on DNA and how changes like methylation and phosphorylation of histones impact gene expression and regulation. However, our increased understanding of RNA modifications and their importance in cellular processes has led to a rise in epitranscriptomics research. “Epitranscriptomics brings together the concepts of epigenetics and gene expression,” explained Adrien Leger, PhD, Principal Research Scientist...
                  04-22-2024, 07:01 AM
                • seqadmin
                  Current Approaches to Protein Sequencing
                  by seqadmin


                  Proteins are often described as the workhorses of the cell, and identifying their sequences is key to understanding their role in biological processes and disease. Currently, the most common technique used to determine protein sequences is mass spectrometry. While still a valuable tool, mass spectrometry faces several limitations and requires a highly experienced scientist familiar with the equipment to operate it. Additionally, other proteomic methods, like affinity assays, are constrained...
                  04-04-2024, 04:25 PM

                ad_right_rmr

                Collapse

                News

                Collapse

                Topics Statistics Last Post
                Started by seqadmin, 04-25-2024, 11:49 AM
                0 responses
                20 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 04-24-2024, 08:47 AM
                0 responses
                20 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 04-11-2024, 12:08 PM
                0 responses
                62 views
                0 likes
                Last Post seqadmin  
                Started by seqadmin, 04-10-2024, 10:19 PM
                0 responses
                61 views
                0 likes
                Last Post seqadmin  
                Working...
                X