Unconfigured Ad

**gringer** · 10-26-2013, 01:13 AM

Here's what I run to generate a BLAST database out of a FASTA file:

Code:

makeblastdb -in <input>.fasta -title 'Something Stringy' -taxid <org_taxid> -dbtype nucl -out <dbname_ID>

It looks like you might be trying to query a database that doesn't exist (or hasn't been generated yet).

However, if you have an NGS-amount of reads, it's probably better to use something other than BLAST for sequence matching. I'd recommend Bowtie2, but BWA seems to also be commonly used here.

Here's the command I'd run to generate a Bowtie2 index:

Code:

bowtie2-build <input>.fasta <dbname_ID>

**maubp** · 10-26-2013, 02:41 AM

Originally posted by yingeddi2008 View Post

I tried changing white space to \s, or add ' before and after each id names, but it didn't help at all. The blastdbcmd program recognizes anything before the space as the id names. Anyone has any idea how to do it? Or I am totally heading in the wrong direction?

Hi Eddi. This is by partly design - most tools consider everything up to the first space as the ID.

However there are also some issues with the blastdbcmd, and the exact version of BLAST+ is important, see my blog post:

My IDs not good enough for NCBI BLAST+

http://blastedbio.blogspot.co.uk/2012/10/my-ids-not-good-enough-for-ncbi-blast.html

The blastdbcmd tool in the BLAST+ suite (replacing fastacmd in the C 'legacy' BLAST suite) lets you do a lot of clever things with a BLAST d...

**yingeddi2008** · 10-26-2013, 08:13 AM

blastdbcmd sucks

Hi maubp,

Thank you very much. I read through your blog. I think that's exactly what I have problem now. Then there is no way I can extract sequences from my own custom database?!

For example, in my database, I have

Code:

>M00344:4:000000000-A5RU9:1:1101:17539:1069 1:N:0:14
AAGAGTTTGATCATGGCTCAGGACGAACGCTGGCGGCGTGCCTAACACATGCAAGTCGAGCGATGAAACCCTTCGGGGTGGATTAGCGGCGGACGGGTGAGTAACACGTGGGCAACCTGCCTCAAAGAGGGGGATAGCCTCCCGAAAGGGAGATTAATACCGCATAATAAGTACTTCTCGCATGGGAAGAACTTTAAAGGAGCAATCCGCTTTGAGATGGGCCCGCGGCGCATTAGCTAGTTGGTGAGGTAAAGGCTCACAAAGGCGACGATGCGTAGCCGACCTGAGAGGGTGATCGGCG
>M00344:4:000000000-A5RU9:1:1101:17556:1074 1:N:0:14
AAGAGTTTGATCATGGCTCAGGACGAACGCTGGCGGCGTGCCTAACACATGCAAGTCGAGCGATGAAACCCTTCGGGGTGGATTAGCGGCGGACGGGTGAGTAACACGTGGGCAACCTGCCTCAAAGAGGGGGATAGCCTCCCGAAAGGGAGATTAATACCGCATAATAAGTACTTCTCGCATGGGAAGAACTTTAAAGGAGCAATCCGCTTTGAGATGGGCCCGCGGCGCATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCGACGATGCGTAGCCGAACTGAGAGGGGGATCGGC

But when I run

Code:

$ blastdbcmd -db seq.fasta -entry all -outfmt "OID: %o     TITLE: %t"

I got nothing back, I don't know whether there is an internal error or it won't recognize any IDs that are not in NCBI format. That is so unfortunate.

Eddi

Originally posted by maubp View Post

Hi Eddi. This is by partly design - most tools consider everything up to the first space as the ID.

However there are also some issues with the blastdbcmd, and the exact version of BLAST+ is important, see my blog post:
http://blastedbio.blogspot.co.uk/201...cbi-blast.html

**yingeddi2008** · 10-26-2013, 08:19 AM

Hi gringer,

Thank you for your advice, I will try Bowtie2 or BWA. I have Illumina Miseq data here. Maybe I should try something else.

Eddi

**maubp** · 10-26-2013, 09:17 AM

Originally posted by yingeddi2008 View Post

Thank you very much. I read through your blog. I think that's exactly what I have problem now.

Please email them to check (and make sure they know people are having problems with blastdbcmd to help prioritise fixing this). Thanks!

Originally posted by yingeddi2008 View Post

Then there is no way I can extract sequences from my own custom database?!

As long as you still have the FASTA file you made the BLAST database from, you can extract the records from the FASTA file. There are several tools for this (including support in scripting libraries like Biopython, BioPerl, BioRuby etc).

**yingeddi2008** · 10-26-2013, 09:35 AM

Thank you.

Hi maubp,

Originally posted by maubp View Post

Please email them to check (and make sure they know people are having problems with blastdbcmd to help prioritise fixing this). Thanks!

Who should I email to? These NCBI guys?

Originally posted by maubp View Post

As long as you still have the FASTA file you made the BLAST database from, you can extract the records from the FASTA file. There are several tools for this (including support in scripting libraries like Biopython, BioPerl, BioRuby etc).

I will try those then. Thank you.

Eddi

**maubp** · 10-26-2013, 09:39 AM

Originally posted by maubp View Post

Please email them to check (and make sure they know people are having problems with blastdbcmd to help prioritise fixing this). Thanks!

blast-help at ncbi.nlm.nih.gov as listed here:

BLAST: Basic Local Alignment Search Tool

http://blast.ncbi.nlm.nih.gov/Blast.cgi?CMD=Web&PAGE_TYPE=Blastdocs

The Basic Local Alignment Search Tool (BLAST) finds regions of local similarity between sequences. The program compares nucleotide or protein sequences to sequence databases and calculates the statistical significance of matches. BLAST can be used to infer functional and evolutionary relationships between sequences as well as help identify members of gene families.

Topics	Statistics	Last Post
Whole-Genome Sequencing Traces Faroe Islands Ancestry to a North Atlantic Founder Population by SEQadmin2 Started by SEQadmin2, 06-17-2026, 06:09 AM	0 responses 25 views 0 reactions	Last Post by SEQadmin2 06-17-2026, 06:09 AM
Sequencing the Two-Toed Sloth Genome Reveals Jumping Genes Tied to Its Extreme Metabolism by SEQadmin2 Started by SEQadmin2, 06-09-2026, 11:58 AM	0 responses 42 views 0 reactions	Last Post by SEQadmin2 06-09-2026, 11:58 AM
A New Method Makes Hantavirus Genome Analysis Faster and More Accessible by SEQadmin2 Started by SEQadmin2, 06-05-2026, 10:09 AM	0 responses 48 views 0 reactions	Last Post by SEQadmin2 06-05-2026, 10:09 AM
A New Single-Cell Method Maps DNA-Protein Interactions by SEQadmin2 Started by SEQadmin2, 06-04-2026, 08:59 AM	0 responses 49 views 0 reactions	Last Post by SEQadmin2 06-04-2026, 08:59 AM

Unconfigured Ad

Problems with blastdbcmd with entry ID contains space

Comment

Comment

Comment

Comment

Comment

Comment

Comment

Latest Articles

ad_right_rmr

News