Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • MerFer
    Member
    • Sep 2009
    • 21

    bowtie2 fragment length

    Dear Bowtie2 user,

    I have a question regarding the fragment length issue.

    The reads that mapped to the different chromosomes sometimes have a fragment length of 0 but sometimes non-0. From the bowtie2 manuel
    I understand that the fragment length has to be non-0 if the mates mapped to the same chromosome.

    "Inferred fragment length. Size is negative if the mate's alignment occurs upstream of this alignment. Size is 0 if the mates did not align concordantly. However, size is non-0 if the mates aligned discordantly to the same chromosome."

    Here is an example from my bowtie2 output:
    Example for 0 fragment length

    MISEQ:52:000000000-A4DCH:1:1101:16444:3647 65 chr9 71742006 24 22M = 3007124 0 TTAATGTCTGTCTCCCTTACTG FFBFFFFGGGGFGGGGGHHHHG AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:21A0 YT:Z:UP
    MISEQ:52:000000000-A4DCH:1:1101:16444:3647 129 chr9 3007124 0 29M = 71742006 0 TCGTCATTTTTCAAGTCGTCAAGGGGATG ABBBBBFFFFFFGGGGGGGGGGCHFEEGG AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:23T5 YT:Z:UP

    Example for non-0 fragment length

    MISEQ:52:000000000-A4DCH:1:1101:17281:1944 65 chr14 54510108 42 23M = 52820128 -1690003 TTAAAGGTAAAAACCACCAACAT BFAFFFF1BGGGGFEF1AGFEGH AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:23 YS:i:0 YT:Z: DP
    MISEQ:52:000000000-A4DCH:1:1101:17281:1944 129 chr14 52820128 42 31M = 54510108 1690003 CCTTGGAAGCCCACTGGAAAAAATGACAGAT AAABAFFFFCFBGGGGGGGGGGGHHHHGHFG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:31 YS:i:0 YT:Z: DP

    Do I miss something or is it a bowtie2 bug?

    Thanks in advance,

    Mary
  • westerman
    Rick Westerman
    • Jun 2008
    • 1104

    #2
    Well both examples are discordant within the same chromosome (chr9 for the first example, chr14 for the second). However in your first example the MAPQ of the second read is 0. This may cause bowtie2 to not want to infer a TLEN (fragment size) thus setting it to 0.

    Comment

    Latest Articles

    Collapse

    • GATTACAT
      Reply to Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by GATTACAT
      Love this - good data definitely starts from good input, and poor input can only give relatively poor data. I particularly like the mention of Nanodrop/absorbance based methods for quantification. It's such a toss up if you'll get an accurate reading or what amounts to a randomly generated number, and a lot of library/sequencing related issues can be traced back to poor quant.
      07-01-2026, 11:43 AM
    • SEQadmin2
      Nine Things a Sample Prep Scientist Thinks About Before Sequencing
      by SEQadmin2


      I’m not a sequencing expert. I’m a purification scientist who uses NGS to evaluate workflows my group develops. With this perspective, we think about the sample first and the NGS workflow second. The sequencer is an exceptionally honest reporter, but it can only report on what you give it, so whether you get clean, interpretable data from an NGS workflow is largely determined before you begin.

      Here are nine questions we think about, in roughly the order they matter, before...
      06-18-2026, 07:11 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Today, 11:05 AM
    0 responses
    6 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-02-2026, 11:08 AM
    0 responses
    27 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-30-2026, 05:37 AM
    0 responses
    25 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 06-26-2026, 11:10 AM
    0 responses
    25 views
    0 reactions
    Last Post SEQadmin2  
    Working...