Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • MerFer
    Member
    • Sep 2009
    • 21

    #1

    bowtie2 fragment length

    Dear Bowtie2 user,

    I have a question regarding the fragment length issue.

    The reads that mapped to the different chromosomes sometimes have a fragment length of 0 but sometimes non-0. From the bowtie2 manuel
    I understand that the fragment length has to be non-0 if the mates mapped to the same chromosome.

    "Inferred fragment length. Size is negative if the mate's alignment occurs upstream of this alignment. Size is 0 if the mates did not align concordantly. However, size is non-0 if the mates aligned discordantly to the same chromosome."

    Here is an example from my bowtie2 output:
    Example for 0 fragment length

    MISEQ:52:000000000-A4DCH:1:1101:16444:3647 65 chr9 71742006 24 22M = 3007124 0 TTAATGTCTGTCTCCCTTACTG FFBFFFFGGGGFGGGGGHHHHG AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:21A0 YT:Z:UP
    MISEQ:52:000000000-A4DCH:1:1101:16444:3647 129 chr9 3007124 0 29M = 71742006 0 TCGTCATTTTTCAAGTCGTCAAGGGGATG ABBBBBFFFFFFGGGGGGGGGGCHFEEGG AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:23T5 YT:Z:UP

    Example for non-0 fragment length

    MISEQ:52:000000000-A4DCH:1:1101:17281:1944 65 chr14 54510108 42 23M = 52820128 -1690003 TTAAAGGTAAAAACCACCAACAT BFAFFFF1BGGGGFEF1AGFEGH AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:23 YS:i:0 YT:Z: DP
    MISEQ:52:000000000-A4DCH:1:1101:17281:1944 129 chr14 52820128 42 31M = 54510108 1690003 CCTTGGAAGCCCACTGGAAAAAATGACAGAT AAABAFFFFCFBGGGGGGGGGGGHHHHGHFG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:31 YS:i:0 YT:Z: DP

    Do I miss something or is it a bowtie2 bug?

    Thanks in advance,

    Mary
  • westerman
    Rick Westerman
    • Jun 2008
    • 1104

    #2
    Well both examples are discordant within the same chromosome (chr9 for the first example, chr14 for the second). However in your first example the MAPQ of the second read is 0. This may cause bowtie2 to not want to infer a TLEN (fragment size) thus setting it to 0.

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      07-31-2026, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, 08-06-2026, 07:41 AM
    0 responses
    15 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-03-2026, 10:13 AM
    0 responses
    31 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-31-2026, 02:55 AM
    0 responses
    41 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 07-24-2026, 12:17 PM
    0 responses
    26 views
    0 reactions
    Last Post SEQadmin2  
    Working...