Seqanswers Leaderboard Ad

Collapse

Announcement

Collapse
No announcement yet.
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • bowtie2 fragment length

    Dear Bowtie2 user,

    I have a question regarding the fragment length issue.

    The reads that mapped to the different chromosomes sometimes have a fragment length of 0 but sometimes non-0. From the bowtie2 manuel
    I understand that the fragment length has to be non-0 if the mates mapped to the same chromosome.

    "Inferred fragment length. Size is negative if the mate's alignment occurs upstream of this alignment. Size is 0 if the mates did not align concordantly. However, size is non-0 if the mates aligned discordantly to the same chromosome."

    Here is an example from my bowtie2 output:
    Example for 0 fragment length

    MISEQ:52:000000000-A4DCH:1:1101:16444:3647 65 chr9 71742006 24 22M = 3007124 0 TTAATGTCTGTCTCCCTTACTG FFBFFFFGGGGFGGGGGHHHHG AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:21A0 YT:Z:UP
    MISEQ:52:000000000-A4DCH:1:1101:16444:3647 129 chr9 3007124 0 29M = 71742006 0 TCGTCATTTTTCAAGTCGTCAAGGGGATG ABBBBBFFFFFFGGGGGGGGGGCHFEEGG AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:23T5 YT:Z:UP

    Example for non-0 fragment length

    MISEQ:52:000000000-A4DCH:1:1101:17281:1944 65 chr14 54510108 42 23M = 52820128 -1690003 TTAAAGGTAAAAACCACCAACAT BFAFFFF1BGGGGFEF1AGFEGH AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:23 YS:i:0 YT:Z: DP
    MISEQ:52:000000000-A4DCH:1:1101:17281:1944 129 chr14 52820128 42 31M = 54510108 1690003 CCTTGGAAGCCCACTGGAAAAAATGACAGAT AAABAFFFFCFBGGGGGGGGGGGHHHHGHFG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:31 YS:i:0 YT:Z: DP

    Do I miss something or is it a bowtie2 bug?

    Thanks in advance,

    Mary

  • #2
    Well both examples are discordant within the same chromosome (chr9 for the first example, chr14 for the second). However in your first example the MAPQ of the second read is 0. This may cause bowtie2 to not want to infer a TLEN (fragment size) thus setting it to 0.

    Comment

    Latest Articles

    Collapse

    • seqadmin
      Best Practices for Single-Cell Sequencing Analysis
      by seqadmin



      While isolating and preparing single cells for sequencing was historically the bottleneck, recent technological advancements have shifted the challenge to data analysis. This highlights the rapidly evolving nature of single-cell sequencing. The inherent complexity of single-cell analysis has intensified with the surge in data volume and the incorporation of diverse and more complex datasets. This article explores the challenges in analysis, examines common pitfalls, offers...
      06-06-2024, 07:15 AM
    • seqadmin
      Latest Developments in Precision Medicine
      by seqadmin



      Technological advances have led to drastic improvements in the field of precision medicine, enabling more personalized approaches to treatment. This article explores four leading groups that are overcoming many of the challenges of genomic profiling and precision medicine through their innovative platforms and technologies.

      Somatic Genomics
      “We have such a tremendous amount of genetic diversity that exists within each of us, and not just between us as individuals,”...
      05-24-2024, 01:16 PM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, 06-21-2024, 07:49 AM
    0 responses
    14 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-20-2024, 07:23 AM
    0 responses
    14 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-17-2024, 06:54 AM
    0 responses
    16 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-14-2024, 07:24 AM
    0 responses
    25 views
    0 likes
    Last Post seqadmin  
    Working...
    X