Header Leaderboard Ad

Collapse

bowtie2 fragment length

Collapse

Announcement

Collapse

SEQanswers June Challenge Has Begun!

The competition has begun! We're giving away a $50 Amazon gift card to the member who answers the most questions on our site during the month. We want to encourage our community members to share their knowledge and help each other out by answering questions related to sequencing technologies, genomics, and bioinformatics. The competition is open to all members of the site, and the winner will be announced at the beginning of July. Best of luck!

For a list of the official rules, visit (https://www.seqanswers.com/forum/sit...wledge-and-win)
See more
See less
X
 
  • Filter
  • Time
  • Show
Clear All
new posts

  • bowtie2 fragment length

    Dear Bowtie2 user,

    I have a question regarding the fragment length issue.

    The reads that mapped to the different chromosomes sometimes have a fragment length of 0 but sometimes non-0. From the bowtie2 manuel
    I understand that the fragment length has to be non-0 if the mates mapped to the same chromosome.

    "Inferred fragment length. Size is negative if the mate's alignment occurs upstream of this alignment. Size is 0 if the mates did not align concordantly. However, size is non-0 if the mates aligned discordantly to the same chromosome."

    Here is an example from my bowtie2 output:
    Example for 0 fragment length

    MISEQ:52:000000000-A4DCH:1:1101:16444:3647 65 chr9 71742006 24 22M = 3007124 0 TTAATGTCTGTCTCCCTTACTG FFBFFFFGGGGFGGGGGHHHHG AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:21A0 YT:Z:UP
    MISEQ:52:000000000-A4DCH:1:1101:16444:3647 129 chr9 3007124 0 29M = 71742006 0 TCGTCATTTTTCAAGTCGTCAAGGGGATG ABBBBBFFFFFFGGGGGGGGGGCHFEEGG AS:i:-5 XN:i:0 XM:i:1 XO:i:0 XG:i:0 NM:i:1 MD:Z:23T5 YT:Z:UP

    Example for non-0 fragment length

    MISEQ:52:000000000-A4DCH:1:1101:17281:1944 65 chr14 54510108 42 23M = 52820128 -1690003 TTAAAGGTAAAAACCACCAACAT BFAFFFF1BGGGGFEF1AGFEGH AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:23 YS:i:0 YT:Z: DP
    MISEQ:52:000000000-A4DCH:1:1101:17281:1944 129 chr14 52820128 42 31M = 54510108 1690003 CCTTGGAAGCCCACTGGAAAAAATGACAGAT AAABAFFFFCFBGGGGGGGGGGGHHHHGHFG AS:i:0 XN:i:0 XM:i:0 XO:i:0 XG:i:0 NM:i:0 MD:Z:31 YS:i:0 YT:Z: DP

    Do I miss something or is it a bowtie2 bug?

    Thanks in advance,

    Mary

  • #2
    Well both examples are discordant within the same chromosome (chr9 for the first example, chr14 for the second). However in your first example the MAPQ of the second read is 0. This may cause bowtie2 to not want to infer a TLEN (fragment size) thus setting it to 0.

    Comment

    Latest Articles

    Collapse

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by seqadmin, Today, 07:14 AM
    0 responses
    4 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, Yesterday, 01:08 PM
    0 responses
    6 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-01-2023, 08:56 PM
    0 responses
    40 views
    0 likes
    Last Post seqadmin  
    Started by seqadmin, 06-01-2023, 07:33 AM
    0 responses
    177 views
    0 likes
    Last Post seqadmin  
    Working...
    X