Tophat: segment join failed with err = -11

[ytmnd85]

Hello all,
I am attempting to use Tophat to analyze some RNA-Seq data I recently acquired for Soybean. During my run, I received an error stating that tophat failed when trying to join segment hits. Below is the output:

[Mon Feb 15 16:38:06 2010] Beginning TopHat run (v1.0.12)
-----------------------------------------------
[Mon Feb 15 16:38:06 2010] Preparing output location ./tophat_out/
[Mon Feb 15 16:38:06 2010] Checking for Bowtie index files
[Mon Feb 15 16:38:06 2010] Checking for reference FASTA file
Warning: Could not find FASTA file /home/weeks/andrew/soybean_database/soybean_cds.fa
[Mon Feb 15 16:38:06 2010] Reconstituting reference FASTA file from Bowtie index
[Mon Feb 15 16:38:34 2010] Checking for Bowtie
Bowtie version: 0.12.1.0
[Mon Feb 15 16:38:34 2010] Checking reads
seed length: 50bp
format: fastq
quality scale: --phred33-quals
[Mon Feb 15 17:00:17 2010] Mapping reads against soybean_cds with Bowtie
[Mon Feb 15 19:36:11 2010] Joining segment hits
[FAILED]
Error: Segment join failed with err = -11


Does anyone know what this error might be caused by? I'm not sure if it has something to do with my fastq read data, but here is an example of my reads in fastq format:

9B=6&?@<=<@@B@97@B<B@@B=2@9;?B;57;3<BB;?>@83<A;@
@HWI-EAS258_1_1_7_1218#0/1
CAGGNTTCAAAACTACAAAAGACAACTATGTAGAAACACGGTGGAGTGGG
+
BC@:&>BCB=CCC?;?CAA==BCC@CB@>B2AC7@C@@,<>5;BB>34CB
@HWI-EAS258_1_1_7_214#0/1
GAAANTTCTGGAGAAGGGGAGTGGCATTGAGCGCCCTGGTGATCTTGATG
+
5@C?&<CC@@2@5CCC;@5CB;CACCCC5ABA6CBCCBCCACCCBB>CC<
@HWI-EAS258_1_1_7_1921#0/1
GGAACATCGTATCTGCTAAACTAAACCCACCCTCTTTGTAACCACAATGG


Thank you for your help.

[sdarko]

What parameters did you use in your command line input?

[ytmnd85]

I essentially just followed default parameters this time. My command line was as follows:

[andrew@veeshan tophat_analysis]$ /arch/tophat/tophat ~/soybean_database/soybean_cds ../reads/soybean_control_1_sequence.fq,../reads/soybean_control_2_sequence.fq,../reads/soybean_control_3_sequence_gr.fq

[bcalder]

I realize that I am resurrecting a dead post, but in the interest of documentation, I also got the "Segment join failed with err = -11" error from long_spanning_reads in version 1.1.4. By bisecting the fastq file I was able to track it down to a single read that spanned a splice junction over an incorrectly annotated gene in the GTF file ("exon number" out of sequence). Updating the GTF fixed the behavior.

[shuiwei]

I realize that I am resurrecting a dead post, but in the interest of documentation, I also got the "Segment join failed with err = -11" error from long_spanning_reads in version 1.1.4. By bisecting the fastq file I was able to track it down to a single read that spanned a splice junction over an incorrectly annotated gene in the GTF file ("exon number" out of sequence). Updating the GTF fixed the behavior.

Could you share which gene is incorrectly annotated because I have the same problem but I have no idea how to find the incorrectly annotated gene?