Hello all,
I am attempting to use Tophat to analyze some RNA-Seq data I recently acquired for Soybean. During my run, I received an error stating that tophat failed when trying to join segment hits. Below is the output:
[Mon Feb 15 16:38:06 2010] Beginning TopHat run (v1.0.12)
-----------------------------------------------
[Mon Feb 15 16:38:06 2010] Preparing output location ./tophat_out/
[Mon Feb 15 16:38:06 2010] Checking for Bowtie index files
[Mon Feb 15 16:38:06 2010] Checking for reference FASTA file
Warning: Could not find FASTA file /home/weeks/andrew/soybean_database/soybean_cds.fa
[Mon Feb 15 16:38:06 2010] Reconstituting reference FASTA file from Bowtie index
[Mon Feb 15 16:38:34 2010] Checking for Bowtie
Bowtie version: 0.12.1.0
[Mon Feb 15 16:38:34 2010] Checking reads
seed length: 50bp
format: fastq
quality scale: --phred33-quals
[Mon Feb 15 17:00:17 2010] Mapping reads against soybean_cds with Bowtie
[Mon Feb 15 19:36:11 2010] Joining segment hits
[FAILED]
Error: Segment join failed with err = -11
Does anyone know what this error might be caused by? I'm not sure if it has something to do with my fastq read data, but here is an example of my reads in fastq format:
9B=6&?@<=<@@B@97@B<B@@B=2@9;?B
;57;3<BB;?>@83<A;@
@HWI-EAS258_1_1_7_1218#0/1
CAGGNTTCAAAACTACAAAAGACAACTATGTAGAAACACGGTGGAGTGGG
+
BC@:&>BCB=CCC?;?CAA==BCC@CB@>B2AC7@C@@,<>5;BB>34CB
@HWI-EAS258_1_1_7_214#0/1
GAAANTTCTGGAGAAGGGGAGTGGCATTGAGCGCCCTGGTGATCTTGATG
+
5@C?&<CC@@2@5CCC;@5CB;CACCCC5ABA6CBCCBCCACCCBB>CC<
@HWI-EAS258_1_1_7_1921#0/1
GGAACATCGTATCTGCTAAACTAAACCCACCCTCTTTGTAACCACAATGG
Thank you for your help.
I am attempting to use Tophat to analyze some RNA-Seq data I recently acquired for Soybean. During my run, I received an error stating that tophat failed when trying to join segment hits. Below is the output:
[Mon Feb 15 16:38:06 2010] Beginning TopHat run (v1.0.12)
-----------------------------------------------
[Mon Feb 15 16:38:06 2010] Preparing output location ./tophat_out/
[Mon Feb 15 16:38:06 2010] Checking for Bowtie index files
[Mon Feb 15 16:38:06 2010] Checking for reference FASTA file
Warning: Could not find FASTA file /home/weeks/andrew/soybean_database/soybean_cds.fa
[Mon Feb 15 16:38:06 2010] Reconstituting reference FASTA file from Bowtie index
[Mon Feb 15 16:38:34 2010] Checking for Bowtie
Bowtie version: 0.12.1.0
[Mon Feb 15 16:38:34 2010] Checking reads
seed length: 50bp
format: fastq
quality scale: --phred33-quals
[Mon Feb 15 17:00:17 2010] Mapping reads against soybean_cds with Bowtie
[Mon Feb 15 19:36:11 2010] Joining segment hits
[FAILED]
Error: Segment join failed with err = -11
Does anyone know what this error might be caused by? I'm not sure if it has something to do with my fastq read data, but here is an example of my reads in fastq format:
9B=6&?@<=<@@B@97@B<B@@B=2@9;?B
;57;3<BB;?>@83<A;@@HWI-EAS258_1_1_7_1218#0/1
CAGGNTTCAAAACTACAAAAGACAACTATGTAGAAACACGGTGGAGTGGG
+
BC@:&>BCB=CCC?;?CAA==BCC@CB@>B2AC7@C@@,<>5;BB>34CB
@HWI-EAS258_1_1_7_214#0/1
GAAANTTCTGGAGAAGGGGAGTGGCATTGAGCGCCCTGGTGATCTTGATG
+
5@C?&<CC@@2@5CCC;@5CB;CACCCC5ABA6CBCCBCCACCCBB>CC<
@HWI-EAS258_1_1_7_1921#0/1
GGAACATCGTATCTGCTAAACTAAACCCACCCTCTTTGTAACCACAATGG
Thank you for your help.
Comment