Unconfigured Ad

Collapse
X
 
  • Filter
  • Time
  • Show
Clear All
new posts
  • ytmnd85
    Member
    • Apr 2009
    • 10

    Tophat: segment join failed with err = -11

    Hello all,
    I am attempting to use Tophat to analyze some RNA-Seq data I recently acquired for Soybean. During my run, I received an error stating that tophat failed when trying to join segment hits. Below is the output:

    [Mon Feb 15 16:38:06 2010] Beginning TopHat run (v1.0.12)
    -----------------------------------------------
    [Mon Feb 15 16:38:06 2010] Preparing output location ./tophat_out/
    [Mon Feb 15 16:38:06 2010] Checking for Bowtie index files
    [Mon Feb 15 16:38:06 2010] Checking for reference FASTA file
    Warning: Could not find FASTA file /home/weeks/andrew/soybean_database/soybean_cds.fa
    [Mon Feb 15 16:38:06 2010] Reconstituting reference FASTA file from Bowtie index
    [Mon Feb 15 16:38:34 2010] Checking for Bowtie
    Bowtie version: 0.12.1.0
    [Mon Feb 15 16:38:34 2010] Checking reads
    seed length: 50bp
    format: fastq
    quality scale: --phred33-quals
    [Mon Feb 15 17:00:17 2010] Mapping reads against soybean_cds with Bowtie
    [Mon Feb 15 19:36:11 2010] Joining segment hits
    [FAILED]
    Error: Segment join failed with err = -11


    Does anyone know what this error might be caused by? I'm not sure if it has something to do with my fastq read data, but here is an example of my reads in fastq format:

    9B=6&?@<=<@@B@97@B<B@@B=2@9;?B;57;3<BB;?>@83<A;@
    @HWI-EAS258_1_1_7_1218#0/1
    CAGGNTTCAAAACTACAAAAGACAACTATGTAGAAACACGGTGGAGTGGG
    +
    BC@:&>BCB=CCC?;?CAA==BCC@CB@>B2AC7@C@@,<>5;BB>34CB
    @HWI-EAS258_1_1_7_214#0/1
    GAAANTTCTGGAGAAGGGGAGTGGCATTGAGCGCCCTGGTGATCTTGATG
    +
    5@C?&<CC@@2@5CCC;@5CB;CACCCC5ABA6CBCCBCCACCCBB>CC<
    @HWI-EAS258_1_1_7_1921#0/1
    GGAACATCGTATCTGCTAAACTAAACCCACCCTCTTTGTAACCACAATGG


    Thank you for your help.
  • sdarko
    Member
    • Apr 2009
    • 52

    #2
    What parameters did you use in your command line input?

    Comment

    • ytmnd85
      Member
      • Apr 2009
      • 10

      #3
      I essentially just followed default parameters this time. My command line was as follows:

      [andrew@veeshan tophat_analysis]$ /arch/tophat/tophat ~/soybean_database/soybean_cds ../reads/soybean_control_1_sequence.fq,../reads/soybean_control_2_sequence.fq,../reads/soybean_control_3_sequence_gr.fq

      Comment

      • bcalder
        Junior Member
        • Sep 2008
        • 3

        #4
        I realize that I am resurrecting a dead post, but in the interest of documentation, I also got the "Segment join failed with err = -11" error from long_spanning_reads in version 1.1.4. By bisecting the fastq file I was able to track it down to a single read that spanned a splice junction over an incorrectly annotated gene in the GTF file ("exon number" out of sequence). Updating the GTF fixed the behavior.

        Comment

        • shuiwei
          Junior Member
          • Jun 2011
          • 1

          #5
          Originally posted by bcalder View Post
          I realize that I am resurrecting a dead post, but in the interest of documentation, I also got the "Segment join failed with err = -11" error from long_spanning_reads in version 1.1.4. By bisecting the fastq file I was able to track it down to a single read that spanned a splice junction over an incorrectly annotated gene in the GTF file ("exon number" out of sequence). Updating the GTF fixed the behavior.
          Could you share which gene is incorrectly annotated because I have the same problem but I have no idea how to find the incorrectly annotated gene?

          Comment

          Latest Articles

          Collapse

          • SEQadmin2
            From Collection to Sequencing: Why Sample Preparation and Preservation Define Sequencing Data
            by SEQadmin2


            Data variability is still an issue in sequencing technologies despite the advances in reproducibility and accuracy of these platforms. But the problem does not originate in the sequencing itself, but in the previous steps, before the sample reaches the sequencer.


            The first step is collection, followed by preservation and sample preparation for analysis. Most scientists overlook those steps, but not being careful might just be skewing the experiment’s results.
            ...
            06-02-2026, 10:05 AM
          • SEQadmin2
            Single-Cell Sequencing at an Inflection Point: Early Impacts of New Platforms and Emerging Trends
            by SEQadmin2


            With the launch of new single-cell sequencing platforms in 2026, the field stands at an exciting inflection point. This article surveys the most impactful advances in the field and discusses how they’re reshaping research in cancer, immunology, and beyond.


            Introduction

            Single-cell sequencing technologies have undergone remarkable advances over the past decade, transitioning from low-throughput experimental approaches to highly scalable platforms capable of...
            05-22-2026, 06:42 AM
          • SEQadmin2
            Environmental Genomics in the Age of NGS: From Microbes to Conservation Strategies
            by SEQadmin2

            Studying ecosystems means dealing with complex, multi-species communities that are hard to observe at scale. This complexity, however, hides many important questions to be answered, from how biogeochemical cycles work and how climate change can affect species distribution to how conservation strategies can work best.


            Genomics, particularly since the expansion of NGS, has transformed ecosystem ecology. By sequencing environmental DNA, we can now assess biodiversity without direct...
            05-06-2026, 09:04 AM

          ad_right_rmr

          Collapse

          News

          Collapse

          Topics Statistics Last Post
          Started by SEQadmin2, Yesterday, 08:59 AM
          0 responses
          14 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-02-2026, 12:03 PM
          0 responses
          22 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 06-02-2026, 11:40 AM
          0 responses
          19 views
          0 reactions
          Last Post SEQadmin2  
          Started by SEQadmin2, 05-28-2026, 11:40 AM
          0 responses
          32 views
          0 reactions
          Last Post SEQadmin2  
          Working...