Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • Mike DS
    Junior Member
    • Dec 2013
    • 6

    #1

    amos2ace gives up at 2Gb?

    Has anyone successfully converted an .afg assembly file (>= 3Gb) to .ace using amos2ace? I am unable to do this on a macbook pro (8 Gb RAM) as the output .ace file is truncated.

    Details:
    I have been given an .afg file assembly, and can convert it to .bnk (with hawkeye), but when I want to convert to .ace (using amos2ace) the resulting .ace file is truncated part way through the phd file descriptions. So when I try and import into Consed, it very rightly complains that there are very many missing .phd files.
    The original .afg is 3 Gb, and amos2ace gives a (truncated) .ace file of 1.93 Gb. When I look inside it, it looks fine until it just stops (see below).
    - Mike DS

    -----------------------just the last bit below-----------------
    QA 1 251 1 251
    DS CHROMAT_FILE: 5387375 PHD_FILE: 5387375.phd.1 TIME: Thu Dec 12 00:14:39 2013
    RD 5393237 228 0 0
    CTGGCTGTCTATGCCTTCCCACATCGTTTCCCACTTAACCATGACTTTGG
    GACCTTAGCTGGCGGTCTGGGTTGTTTCCCTCTTCACGACGGACGTTAGC
    ACCCGCCGTGTGTCTCCCGTGATAACATTCTTCGGTATTCGGAGTTTGCA
    TCGAGTTGGTAAGCCGGGATGGCCCCCTAGTCGAAACAGTGCTCTACCCC
    CGAAGATGAATTCACGAGGCGCTACCTA

    QA 1 228 1 228
    DS CHROMAT_FILE: 5393237 PHD_FILE: 5393237.phd.1 TIME: Thu Dec 12 00:14:40 2013

    Wamos2ace $Revision$
    Run by root on Thu 12 Dec 2013 00:15:39 EST
    }
  • Mike DS
    Junior Member
    • Dec 2013
    • 6

    #2
    follow up - converted to BAM

    So, I gave up trying to get an .ace file. I converted the .afg to .bnk format, then .bnk to SAM, then SAM to BAM, and can now view the assembly very nicely in Tablet.
    Now I can see the velvet assemblies, I notice many have crazy alignments for the first 250 nt; then an abrupt change to perfect alignment.
    - Mike DS

    Comment

    Latest Articles

    Collapse

    • SEQadmin2
      Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
      by SEQadmin2



      CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

      Despite this, “CRISPR helped turn genome editing from a specialized technique into
      ...
      07-31-2026, 11:01 AM
    • SEQadmin2
      Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
      by SEQadmin2


      Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

      The systematic characterization of the human proteome has
      ...
      07-20-2026, 11:48 AM

    ad_right_rmr

    Collapse

    News

    Collapse

    Topics Statistics Last Post
    Started by SEQadmin2, Yesterday, 12:22 PM
    0 responses
    12 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-11-2026, 10:35 AM
    0 responses
    14 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-06-2026, 07:41 AM
    0 responses
    31 views
    0 reactions
    Last Post SEQadmin2  
    Started by SEQadmin2, 08-03-2026, 10:13 AM
    0 responses
    49 views
    0 reactions
    Last Post SEQadmin2  
    Working...