Unconfigured Ad

Collapse
X
 
  • Time
  • Show
Clear All
new posts
  • OTU
    Member
    • May 2013
    • 44

    #256
    Through yum - got success! Thank you!
    And with libz2:
    [root@localhost Ray-v2.2.0]# file -L /usr/lib64/libbz2.so
    /usr/lib64/libbz2.so: ELF 64-bit LSB shared object, x86-64, version 1 (SYSV), dynamically linked, BuildID[sha1]=0x7705fc6fbd1d6aa0ffde9b4f54189a5b637e3ee0, stripped

    Is this ok?

    Comment

    • seb567
      Senior Member
      • Jul 2008
      • 260

      #257
      Originally posted by OTU View Post
      Through yum - got success! Thank you!
      And with libz2:
      [root@localhost Ray-v2.2.0]# file -L /usr/lib64/libbz2.so
      /usr/lib64/libbz2.so: ELF 64-bit LSB shared object, x86-64, version 1 (SYSV), dynamically linked, BuildID[sha1]=0x7705fc6fbd1d6aa0ffde9b4f54189a5b637e3ee0, stripped

      Is this ok?
      The package you installed with yum is 2.1.0-6.fc19 (not 2.2.0).


      So if you also want 2.2.0, can you try this (with gz support but without bz2 support):


      make clean
      make HAVE_LIBZ=y HAVE_LIBBZ2=n

      Comment

      • OTU
        Member
        • May 2013
        • 44

        #258
        Em....

        And after this, what should I do? Does this mean the end of installation of Ray-v2.2.0?
        I am sorry, I am just confused with all this stuff...

        Comment

        • seb567
          Senior Member
          • Jul 2008
          • 260

          #259
          Originally posted by OTU View Post
          Em....

          And after this, what should I do? Does this mean the end of installation of Ray-v2.2.0?
          I am sorry, I am just confused with all this stuff...
          No. The command above is to build Ray with gz support but no bz2 support.


          Did you try:

          make clean
          make HAVE_LIBZ=y HAVE_LIBBZ2=n

          Comment

          • Brian E
            Junior Member
            • Oct 2010
            • 5

            #260
            So, to add to an already massive thread, it's looking like Ray is going to be the assembler we're going to be using for our Metagenome work, and I was wondering if it is possible to obtain the location that each read ends up in the assembly. We're using multiple biological replicates, sequenced separately (multiplexed) and we know that there is some variation in the abundance of the organisms that are present in the community. What I would like is the contribution of each individual sample to the local coverage of the whole assembly. I think this could help with pulling out individual genomes.
            I know could get at this by mapping with e.g. Bowtie, but if it is possible to keep track of where these reads are ending up, it would save a significant amount of time on our computer cluster allocation. Is this possible?

            Comment

            • seb567
              Senior Member
              • Jul 2008
              • 260

              #261
              Originally posted by Brian E View Post
              So, to add to an already massive thread, it's looking like Ray is going to be the assembler we're going to be using for our Metagenome work,

              There is a thread for Ray Meta (Ray for Metagenomics):

              Discussion of any scientific study related to high content or next generation genomics. Whole genome association, metagenomics, digital gene expression, etc.


              Paper: http://genomebiology.com/2012/13/12/R122

              Originally posted by Brian E View Post

              and I was wondering if it is possible to obtain the location that each read ends up in the assembly.
              There is the -amos option, but on the mailing list, I see more people relying on post-assembly read mapping onto the contigs.

              Originally posted by Brian E View Post

              We're using multiple biological replicates, sequenced separately (multiplexed) and we know that there is some variation in the abundance of the organisms that are present in the community. What I would like is the contribution of each individual sample to the local coverage of the whole assembly. I think this could help with pulling out individual genomes.
              If you are sequencing barcoded samples, then demultiplexing should be done before feeding the data to Ray.

              Originally posted by Brian E View Post

              I know could get at this by mapping with e.g. Bowtie, but if it is possible to keep track of where these reads are ending up, it would save a significant amount of time on our computer cluster allocation. Is this possible?
              As stated above, Ray can generate an AMOS file, which contains read usage.

              Séb

              Comment

              • bossanova352
                Junior Member
                • Mar 2013
                • 9

                #262
                I'm trying to use Ray on some environmental metagenomes, but every time I set up a run, the output contig and scaffold files are empty. I haven't seen any indication during the assembly run, and all sequences are recognized by Ray. One possibility that comes to mind is from some errors that came up while compiling. Specifically, when trying to use the make install command, an error pops up saying there is no README file in ray-build/RayPlatform. If I place the README file in RayPlatform and try again, I get an error saying there is already a file named RayPlatform.

                Edit: After reinstalling Ray with the developer package, there are no installation errors. As of now, I'm stumped why there are no assembled sequences in either of the output Contigs.fasta or Scaffolds.fasta files.
                Last edited by bossanova352; 01-12-2014, 12:25 AM.

                Comment

                • VidJa
                  Junior Member
                  • Apr 2010
                  • 7

                  #263
                  I'm trying to use Ray with a mix of Illumina SE and 454 data using the -amos
                  mpiexec -n 10 Ray -s illumina.fasta -s 454.fasta -k 31 -amos -o mix
                  454 reads have an avg length of 396bp and the illumina reads are 60bp

                  The resulting amos file AMOS.afg can be browsed using Tablet, but I noticed that the original read names are converted to just a number and thus making it impossible to easily trace which reads end up in a particular contig. Is it possible to save the original readnames in the AMOS output?

                  Comment

                  • seb567
                    Senior Member
                    • Jul 2008
                    • 260

                    #264
                    Originally posted by bossanova352 View Post
                    I'm trying to use Ray on some environmental metagenomes, but every time I set up a run, the output contig and scaffold files are empty. I haven't seen any indication during the assembly run, and all sequences are recognized by Ray. One possibility that comes to mind is from some errors that came up while compiling. Specifically, when trying to use the make install command, an error pops up saying there is no README file in ray-build/RayPlatform. If I place the README file in RayPlatform and try again, I get an error saying there is already a file named RayPlatform.

                    Edit: After reinstalling Ray with the developer package, there are no installation errors. As of now, I'm stumped why there are no assembled sequences in either of the output Contigs.fasta or Scaffolds.fasta files.
                    What is the content of RayOutput/NumberOfSequences.txt ?

                    Do you have any error in your standard output file ? ("grep Error log.stdout")

                    Comment

                    • seb567
                      Senior Member
                      • Jul 2008
                      • 260

                      #265
                      Originally posted by VidJa View Post
                      I'm trying to use Ray with a mix of Illumina SE and 454 data using the -amos
                      mpiexec -n 10 Ray -s illumina.fasta -s 454.fasta -k 31 -amos -o mix
                      454 reads have an avg length of 396bp and the illumina reads are 60bp

                      The resulting amos file AMOS.afg can be browsed using Tablet, but I noticed that the original read names are converted to just a number and thus making it impossible to easily trace which reads end up in a particular contig. Is it possible to save the original readnames in the AMOS output?
                      This is not currently possible because Ray does not read or store read names at all.

                      Comment

                      • bossanova352
                        Junior Member
                        • Mar 2013
                        • 9

                        #266
                        Originally posted by seb567 View Post
                        What is the content of RayOutput/NumberOfSequences.txt ?

                        Do you have any error in your standard output file ? ("grep Error log.stdout")
                        The output of NumberOfSequences.txt is:

                        Files: 1

                        FileNumber: 0
                        FilePath: ../SFBloom_paired_trimmed_1.fa
                        NumberOfSequences: 7917760
                        FirstSequence: 0
                        LastSequence: 7917759

                        Summary
                        NumberOfSequences: 7917760
                        FirstSequence: 0
                        LastSequence: 7917759
                        This is what I find in the stdoutput file a considerable way through. I think the issue lies in what I've quoted below, as there are seeds before this and everything goes to 0 afterwards. It looks like it's skipping all paths because of short length:

                        Rank 8 has 0 seeds
                        Rank 8 is creating seeds [147526/147526] (completed)
                        Rank 8: peak number of workers: 1887, maximum: 32768
                        Rank 8 : VirtualCommunicator (service provided by VirtualCommunicator): 494068 virtual messages generated 4040 real messages (0.817701%)
                        Rank 8 runtime statistics for seeding algorithm:
                        Rank 8 Skipped paths because of dead end for head: 0
                        Rank 8 Skipped paths because of dead end for tail: 0
                        Rank 8 Skipped paths because of two dead ends: 0
                        Rank 8 Skipped paths because of bubble weak component: 0
                        Rank 8 Skipped paths because of short length: 147526
                        Rank 8 Skipped paths because of bad ownership: 0
                        Rank 8 Skipped paths because of low coverage: 0
                        Rank 8 Eligible paths: 0
                        Rank 8: assembler memory usage: 139120 KiB
                        I'm working with Illumina Hiseq paired end 100 bp reads which have been trimmed based on quality scores and length, so there should be nothing shorter than 50 bp. Oh, and my command is this:

                        mpiexec -n 10 Ray -k 57 -i ../SFBloom_paired_trimmed_1.fa -o RayOutputTest
                        Last edited by bossanova352; 01-13-2014, 12:03 PM.

                        Comment

                        • seb567
                          Senior Member
                          • Jul 2008
                          • 260

                          #267
                          Originally posted by bossanova352 View Post
                          The output of NumberOfSequences.txt is:



                          This is what I find in the stdoutput file a considerable way through. I think the issue lies in what I've quoted below, as there are seeds before this and everything goes to 0 afterwards. It looks like it's skipping all paths because of short length:



                          I'm working with Illumina Hiseq paired end 100 bp reads which have been trimmed based on quality scores and length, so there should be nothing shorter than 50 bp. Oh, and my command is this:

                          mpiexec -n 10 Ray -k 57 -i ../SFBloom_paired_trimmed_1.fa -o RayOutputTest
                          Can you paste the 10 first lines of your file named SFBloom_paired_trimmed_1.fa ?

                          Comment

                          • bossanova352
                            Junior Member
                            • Mar 2013
                            • 9

                            #268
                            Originally posted by seb567 View Post
                            Can you paste the 10 first lines of your file named SFBloom_paired_trimmed_1.fa ?
                            Yeah, here it is:

                            >DB775P1:2451TDYACXX:2:1101:1582:1958_1:N:0:CGTACTAG
                            ATAATCGTTTGCTCGGCTATTTGAGTTGCAGATATTAATTGTTTACGACGGGATGTATCA
                            AGTTCTGCAAAGACATCATCCAAAATTAGAATGGGTTC
                            >DB775P1:2451TDYACXX:2:1101:1582:1958_2:N:0:CGTACTAG
                            ATGACCTACATCTACAAATCGGAGATTTTCCGGCTAAAGGTTATGCCAGCCACGGTGAAT
                            CCTGGTCAATGGCGATTTCACTACGCATTGGATCTTTTAAT
                            >DB775P1:2451TDYACXX:2:1101:1853:1966_1:N:0:CGTACTAG
                            TTCACCTAGAGAATGACCGGCAACAAAGTGGGGCGTAGGAAGTCGATCCTTGAAAGAGGT
                            GAGGACCATCCAGGAGTGCATTAAAATAGCCGGCTGAG
                            >DB775P1:2451TDYACXX:2:1101:1853:1966_2:N:0:CGTACTAG

                            Comment

                            • seb567
                              Senior Member
                              • Jul 2008
                              • 260

                              #269
                              Originally posted by bossanova352 View Post
                              Yeah, here it is:
                              Each sequence needs to be on one line (this is a current limitation of fasta support in Ray).

                              That's presumably the issue.

                              Comment

                              • bossanova352
                                Junior Member
                                • Mar 2013
                                • 9

                                #270
                                Originally posted by seb567 View Post
                                Each sequence needs to be on one line (this is a current limitation of fasta support in Ray).

                                That's presumably the issue.
                                How silly of me! Well I changed the formatting, but unfortunately I'm still not getting any output from Ray. This is what the file looks like now (all sequences on one line):

                                >DB775P1:2451TDYACXX:2:1101:1582:1958_1:N:0:CGTACTAG
                                AGTTCTGCAAAGACATCATCCAAAATTAGAATGGGTTCTTGTTTACGACGGGATGTATCA
                                >DB775P1:2451TDYACXX:2:1101:1582:1958_2:N:0:CGTACTAG
                                CCTGGTCAATGGCGATTTCACTACGCATTGGATCTTTTAATTATGCCAGCCACGGTGAAT
                                >DB775P1:2451TDYACXX:2:1101:1853:1966_1:N:0:CGTACTAG
                                GAGGACCATCCAGGAGTGCATTAAAATAGCCGGCTGAGGAAGTCGATCCTTGAAAGAGGT
                                >DB775P1:2451TDYACXX:2:1101:1853:1966_2:N:0:CGTACTAG
                                GTCAAGAATGCCATCCGAGCTGCGATGACCAATATCGAGCAAAGTAGCGATGCCCGCGCT
                                >DB775P1:2451TDYACXX:2:1101:2768:1957_1:N:0:CGTACTAG
                                GTTGGAGCGCTTGGTATCCTGCGCTCCAATATTCATCACAGTGGGAATGACGCCCCCTAC
                                Again, it looks like this step has some clues as to what is going on:

                                Rank 2 has 12675 seeds
                                Rank 2 is creating seeds [2985784/2985784] (completed)
                                Rank 2: peak number of workers: 2002, maximum: 32768
                                Rank 2 : VirtualCommunicator (service provided by VirtualCommunicator): 19245610
                                Rank 2 runtime statistics for seeding algorithm:
                                Rank 2 Skipped paths because of dead end for head: 0
                                Rank 2 Skipped paths because of dead end for tail: 0
                                Rank 2 Skipped paths because of two dead ends: 0
                                Rank 2 Skipped paths because of bubble weak component: 0
                                Rank 2 Skipped paths because of short length: 2960369
                                Rank 2 Skipped paths because of bad ownership: 12740
                                Rank 2 Skipped paths because of low coverage: 0
                                Rank 2 Eligible paths: 12675
                                Rank 2: assembler memory usage: 263224 KiB
                                Fixed! It was another formatting issue, (^M characters were showing up after the one-line formatting). Thanks, Seb! I appreciate the help.
                                Last edited by bossanova352; 01-14-2014, 11:34 AM.

                                Comment

                                Latest Articles

                                Collapse

                                • SEQadmin2
                                  Beyond CRISPR/Cas9: Understand, Choose, and Use the Right Genome Editing Tool
                                  by SEQadmin2



                                  CRISPR/Cas9 sparked the gene editing revolution for both research and therapeutics.1 But this system still showed severe issues that limited its applications. The most prominent were the heavy reliance on PAM sequences, delivery limitations, double-stranded breaks that prompt unintended edits and cell death, and editing inefficiency (both in targeting and in knock-in reliability).

                                  Despite this, “CRISPR helped turn genome editing from a specialized technique into
                                  ...
                                  07-31-2026, 11:01 AM
                                • SEQadmin2
                                  Proteomic Platforms: How to Choose the Right Analytical Strategy to Improve Detection and Clinical Applications
                                  by SEQadmin2


                                  Proteomics platforms are evolving rapidly, with advances in mass spectrometry and affinity-based approaches expanding what researchers can detect and at what scale. As the field moves toward deeper proteome coverage and clinical applications, scientists face an increasingly complex landscape of tools. This article will explore how researchers are navigating these choices to find the right platform for their work.

                                  The systematic characterization of the human proteome has
                                  ...
                                  07-20-2026, 11:48 AM

                                ad_right_rmr

                                Collapse

                                News

                                Collapse

                                Topics Statistics Last Post
                                Started by SEQadmin2, 08-13-2026, 12:22 PM
                                0 responses
                                22 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-11-2026, 10:35 AM
                                0 responses
                                19 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-06-2026, 07:41 AM
                                0 responses
                                33 views
                                0 reactions
                                Last Post SEQadmin2  
                                Started by SEQadmin2, 08-03-2026, 10:13 AM
                                0 responses
                                51 views
                                0 reactions
                                Last Post SEQadmin2  
                                Working...